Incidental Mutation 'R4389:Gzma'
ID326340
Institutional Source Beutler Lab
Gene Symbol Gzma
Ensembl Gene ENSMUSG00000023132
Gene Namegranzyme A
SynonymsTSP1, Ctla3, H factor, Ctla-3, SE1, serine esterase 1, BLT esterase, TSP-1, Hanukah factor, Hf
MMRRC Submission 041126-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R4389 (G1)
Quality Score137
Status Validated
Chromosome13
Chromosomal Location113093825-113100981 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 113098388 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023897] [ENSMUST00000224282]
Predicted Effect probably null
Transcript: ENSMUST00000023897
SMART Domains Protein: ENSMUSP00000023897
Gene: ENSMUSG00000023132

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Tryp_SPc 28 252 1.1e-80 SMART
Predicted Effect probably null
Transcript: ENSMUST00000224282
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.6%
  • 20x: 92.6%
Validation Efficiency 87% (26/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here is a T cell- and natural killer cell-specific serine protease that may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show normal T/NK cell-mediated cytotoxicity, recovery from LCM virus or L. monocytogenes infection, and control of syngeneic tumor growth. Homozygotes for a different null allele show defective CTL cytolysis and increased tumor burden upon challenge with RMAS cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,297,878 T2542P probably damaging Het
Adprm C T 11: 67,038,193 R324K probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cd209b A G 8: 3,925,960 L67P probably damaging Het
Cfap54 T A 10: 92,967,500 K1560M probably benign Het
Ctps T C 4: 120,558,790 D212G probably damaging Het
Ercc6 T A 14: 32,574,908 L1285* probably null Het
Kng2 T C 16: 23,024,868 I120M possibly damaging Het
Lhx3 C T 2: 26,201,090 probably benign Het
Mtfr1l T C 4: 134,532,642 probably benign Het
Ndufb4 T C 16: 37,647,670 N126S probably benign Het
Nlrp4e A G 7: 23,321,227 I380V probably benign Het
Nptn A G 9: 58,643,772 K361E probably damaging Het
Olfr262 A G 19: 12,241,139 V174A probably damaging Het
Orc2 T C 1: 58,474,861 D332G probably benign Het
Pcdha4 T C 18: 36,954,789 V675A probably benign Het
Rpl7a-ps3 G A 15: 36,308,283 noncoding transcript Het
Slc13a1 A T 6: 24,092,398 probably null Het
Tec A G 5: 72,782,007 Y222H probably benign Het
Ttll2 T A 17: 7,351,200 R443* probably null Het
Vmn1r66 A T 7: 10,274,788 L106* probably null Het
Zfp189 A G 4: 49,529,934 R346G probably damaging Het
Other mutations in Gzma
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01341:Gzma APN 13 113093884 utr 3 prime probably benign
R0965:Gzma UTSW 13 113098334 missense probably damaging 1.00
R1411:Gzma UTSW 13 113096208 missense probably benign 0.13
R1597:Gzma UTSW 13 113095797 missense probably damaging 1.00
R1838:Gzma UTSW 13 113095984 missense probably damaging 0.99
R1950:Gzma UTSW 13 113093929 missense probably damaging 1.00
R4153:Gzma UTSW 13 113096268 missense possibly damaging 0.92
R5370:Gzma UTSW 13 113095795 missense probably damaging 1.00
R5643:Gzma UTSW 13 113098260 missense probably damaging 1.00
R5644:Gzma UTSW 13 113098260 missense probably damaging 1.00
R7771:Gzma UTSW 13 113098295 missense probably damaging 1.00
R7798:Gzma UTSW 13 113096324 missense probably benign 0.06
R8420:Gzma UTSW 13 113100930 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCAGGTTGTCAAAGACTTCC -3'
(R):5'- GCCCAAAAGGGTCAAGACTTAG -3'

Sequencing Primer
(F):5'- TCCATGTGTTAGCGAGATATAGTC -3'
(R):5'- CTTAGGGTGAGACTTCAGGACTAC -3'
Posted On2015-07-06