Mutagenetix > Incidental Mutations

Incidental Mutation 'R4389:Ercc6'

326341

Institutional Source

Beutler Lab

Gene Symbol

Ercc6

Ensembl Gene

ENSMUSG00000054051

Gene Name

excision repair cross-complementing rodent repair deficiency, complementation group 6

Synonyms

CS group B correcting gene, C130058G22Rik, CSB

MMRRC Submission

041126-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.347) question?

Stock #

R4389 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32513521-32580990 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 32574908 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 1285 (L1285*)

Ref Sequence

ENSEMBL: ENSMUSP00000066256 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066807]

Predicted Effect

probably null
Transcript: ENSMUST00000066807
AA Change: L1285*

SMART Domains

Protein: ENSMUSP00000066256
Gene: ENSMUSG00000054051
AA Change: L1285*

Domain	Start	End	E-Value	Type
PDB:4CVO\|A	82	160	1e-36	PDB
low complexity region	286	299	N/A	INTRINSIC
low complexity region	361	390	N/A	INTRINSIC
low complexity region	422	434	N/A	INTRINSIC
low complexity region	460	469	N/A	INTRINSIC
low complexity region	479	491	N/A	INTRINSIC
DEXDc	499	699	8.34e-33	SMART
Blast:DEXDc	720	821	7e-56	BLAST
HELICc	865	948	1.41e-21	SMART
low complexity region	1364	1377	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000228549

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.6%
3x: 98.7%
10x: 96.6%
20x: 92.6%

Validation Efficiency

87% (26/30)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-binding protein that is important in transcription-coupled excision repair. The encoded protein has ATP-stimulated ATPase activity, interacts with several transcription and excision repair proteins, and may promote complex formation at DNA repair sites. Mutations in this gene are associated with Cockayne syndrome type B and cerebrooculofacioskeletal syndrome 1. Alternative splicing occurs between a splice site from exon 5 of this gene to the 3' splice site upstream of the open reading frame (ORF) of the adjacent gene, piggyback-derived-3 (GeneID:267004), which activates the alternative polyadenylation site downstream of the piggyback-derived-3 ORF. The resulting transcripts encode a fusion protein that shares sequence with the product of each individual gene. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutant mice exhibit UV sensitivity, inactivation of transcription-coupled repair, increased incidence of induced skin and eye tumors, circling behavior, impaired coordination and lower body weight. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	C	11: 9,297,878	T2542P	probably damaging	Het
Adprm	C	T	11: 67,038,193	R324K	probably benign	Het
Cd109	CATTTATTTATTTATTTATTTATTTATTTATTTAT	CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	9: 78,712,500		probably benign	Het
Cd209b	A	G	8: 3,925,960	L67P	probably damaging	Het
Cfap54	T	A	10: 92,967,500	K1560M	probably benign	Het
Ctps	T	C	4: 120,558,790	D212G	probably damaging	Het
Gzma	G	T	13: 113,098,388		probably null	Het
Kng2	T	C	16: 23,024,868	I120M	possibly damaging	Het
Lhx3	C	T	2: 26,201,090		probably benign	Het
Mtfr1l	T	C	4: 134,532,642		probably benign	Het
Ndufb4	T	C	16: 37,647,670	N126S	probably benign	Het
Nlrp4e	A	G	7: 23,321,227	I380V	probably benign	Het
Nptn	A	G	9: 58,643,772	K361E	probably damaging	Het
Olfr262	A	G	19: 12,241,139	V174A	probably damaging	Het
Orc2	T	C	1: 58,474,861	D332G	probably benign	Het
Pcdha4	T	C	18: 36,954,789	V675A	probably benign	Het
Rpl7a-ps3	G	A	15: 36,308,283		noncoding transcript	Het
Slc13a1	A	T	6: 24,092,398		probably null	Het
Tec	A	G	5: 72,782,007	Y222H	probably benign	Het
Ttll2	T	A	17: 7,351,200	R443*	probably null	Het
Vmn1r66	A	T	7: 10,274,788	L106*	probably null	Het
Zfp189	A	G	4: 49,529,934	R346G	probably damaging	Het

Other mutations in Ercc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Ercc6	APN	14	32568072	missense	probably damaging	1.00
IGL00796:Ercc6	APN	14	32570002	missense	probably benign	0.01
IGL00916:Ercc6	APN	14	32562655	intron	probably benign
IGL01743:Ercc6	APN	14	32552604	missense	probably damaging	1.00
IGL01802:Ercc6	APN	14	32562574	missense	probably damaging	0.99
IGL01886:Ercc6	APN	14	32569580	missense	possibly damaging	0.90
IGL02100:Ercc6	APN	14	32517095	missense	probably benign	0.00
IGL02115:Ercc6	APN	14	32576993	missense	probably damaging	1.00
IGL02755:Ercc6	APN	14	32575748	splice site	probably benign
IGL02964:Ercc6	APN	14	32570103	missense	probably benign	0.00
IGL02998:Ercc6	APN	14	32557857	missense	probably benign	0.05
IGL03150:Ercc6	APN	14	32558574	missense	probably damaging	0.96
R0152:Ercc6	UTSW	14	32546905	critical splice donor site	probably benign
R0519:Ercc6	UTSW	14	32526842	missense	probably damaging	1.00
R0591:Ercc6	UTSW	14	32558016	splice site	probably benign
R0894:Ercc6	UTSW	14	32517028	missense	probably benign	0.05
R0946:Ercc6	UTSW	14	32552621	missense	probably benign	0.08
R1313:Ercc6	UTSW	14	32552720	splice site	probably benign
R1506:Ercc6	UTSW	14	32569864	missense	probably benign	0.01
R1528:Ercc6	UTSW	14	32519022	missense	probably damaging	0.98
R1711:Ercc6	UTSW	14	32526176	missense	probably damaging	1.00
R1753:Ercc6	UTSW	14	32576999	missense	probably benign
R1795:Ercc6	UTSW	14	32517028	missense	probably benign	0.05
R1843:Ercc6	UTSW	14	32546820	missense	probably damaging	0.99
R1853:Ercc6	UTSW	14	32576816	missense	possibly damaging	0.86
R1859:Ercc6	UTSW	14	32526778	missense	probably damaging	1.00
R1912:Ercc6	UTSW	14	32576803	missense	probably damaging	1.00
R2308:Ercc6	UTSW	14	32566409	missense	possibly damaging	0.70
R2322:Ercc6	UTSW	14	32526317	missense	probably damaging	1.00
R2386:Ercc6	UTSW	14	32541359	splice site	probably null
R4170:Ercc6	UTSW	14	32566797	missense	probably damaging	1.00
R4369:Ercc6	UTSW	14	32517207	missense	probably damaging	0.96
R4747:Ercc6	UTSW	14	32569907	missense	probably benign	0.00
R4811:Ercc6	UTSW	14	32574929	missense	probably benign	0.20
R4840:Ercc6	UTSW	14	32541296	missense	probably damaging	1.00
R4973:Ercc6	UTSW	14	32574902	missense	probably damaging	1.00
R5068:Ercc6	UTSW	14	32570063	missense	probably benign	0.01
R5069:Ercc6	UTSW	14	32570063	missense	probably benign	0.01
R5070:Ercc6	UTSW	14	32570063	missense	probably benign	0.01
R5093:Ercc6	UTSW	14	32567522	missense	probably damaging	1.00
R5265:Ercc6	UTSW	14	32569623	missense	probably benign	0.01
R5272:Ercc6	UTSW	14	32519028	nonsense	probably null
R5499:Ercc6	UTSW	14	32516959	start codon destroyed	probably null	0.98
R5795:Ercc6	UTSW	14	32526352	missense	probably damaging	0.98
R6258:Ercc6	UTSW	14	32557856	missense	probably benign	0.00
R6260:Ercc6	UTSW	14	32557856	missense	probably benign	0.00
R6267:Ercc6	UTSW	14	32526403	nonsense	probably null
R6291:Ercc6	UTSW	14	32569986	missense	probably benign	0.01
R6296:Ercc6	UTSW	14	32526403	nonsense	probably null
R6361:Ercc6	UTSW	14	32517110	missense	probably benign	0.00
R6500:Ercc6	UTSW	14	32526823	missense	probably damaging	0.96
R6555:Ercc6	UTSW	14	32517107	missense	probably benign	0.15
R6724:Ercc6	UTSW	14	32566331	missense	probably benign	0.01
R6925:Ercc6	UTSW	14	32562608	missense	probably damaging	0.99
R7143:Ercc6	UTSW	14	32570305	missense	probably damaging	1.00
R7327:Ercc6	UTSW	14	32526404	missense	probably benign	0.19
R7396:Ercc6	UTSW	14	32569805	missense	probably benign	0.00
R7529:Ercc6	UTSW	14	32560729	nonsense	probably null
R7609:Ercc6	UTSW	14	32566361	missense	probably benign	0.11
R7802:Ercc6	UTSW	14	32517303	missense	probably damaging	1.00
R7854:Ercc6	UTSW	14	32566292	missense	probably damaging	1.00
R7995:Ercc6	UTSW	14	32562569	missense	probably damaging	0.99
R8181:Ercc6	UTSW	14	32557948	missense	probably damaging	1.00
R8320:Ercc6	UTSW	14	32521015	missense	probably benign	0.01
R8388:Ercc6	UTSW	14	32570340	utr 3 prime	probably benign
R8479:Ercc6	UTSW	14	32526406	missense	probably benign	0.00
Z1176:Ercc6	UTSW	14	32526487	missense	probably benign	0.27

Predicted Primers

PCR Primer
(F):5'- TTTCAGTGCAGAGGAATTACTGTG -3'
(R):5'- ACAGAGAACAAGCCTTGGC -3'

Sequencing Primer
(F):5'- CTGTGCATTGTATTATAACGCGTAG -3'
(R):5'- AAGCCTTGGCCTGCCTTG -3'

Posted On

2015-07-06