Incidental Mutation 'R4389:Kng2'
ID326343
Institutional Source Beutler Lab
Gene Symbol Kng2
Ensembl Gene ENSMUSG00000060459
Gene Namekininogen 2
SynonymsKininogen-II
MMRRC Submission 041126-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4389 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location22985854-23029482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23024868 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 120 (I120M)
Ref Sequence ENSEMBL: ENSMUSP00000046867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039338] [ENSMUST00000100046] [ENSMUST00000115349] [ENSMUST00000160243] [ENSMUST00000231835] [ENSMUST00000232459]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039338
AA Change: I120M

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000046867
Gene: ENSMUSG00000060459
AA Change: I120M

DomainStartEndE-ValueType
CY 18 126 3.72e-19 SMART
CY 140 248 2.57e-22 SMART
CY 262 370 2.06e-35 SMART
low complexity region 376 390 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100046
AA Change: I120M

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097623
Gene: ENSMUSG00000060459
AA Change: I120M

DomainStartEndE-ValueType
CY 18 126 3.72e-19 SMART
CY 140 248 2.57e-22 SMART
CY 262 370 2.06e-35 SMART
low complexity region 376 390 N/A INTRINSIC
low complexity region 478 506 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115349
AA Change: I120M

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000111006
Gene: ENSMUSG00000060459
AA Change: I120M

DomainStartEndE-ValueType
CY 18 126 3.72e-19 SMART
CY 140 248 2.57e-22 SMART
CY 262 370 2.06e-35 SMART
low complexity region 376 390 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160243
AA Change: I120M

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124161
Gene: ENSMUSG00000060459
AA Change: I120M

DomainStartEndE-ValueType
CY 18 126 3.72e-19 SMART
Blast:CY 140 171 2e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000231835
Predicted Effect probably benign
Transcript: ENSMUST00000232459
AA Change: I56M

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.6%
  • 20x: 92.6%
Validation Efficiency 87% (26/30)
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,297,878 T2542P probably damaging Het
Adprm C T 11: 67,038,193 R324K probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cd209b A G 8: 3,925,960 L67P probably damaging Het
Cfap54 T A 10: 92,967,500 K1560M probably benign Het
Ctps T C 4: 120,558,790 D212G probably damaging Het
Ercc6 T A 14: 32,574,908 L1285* probably null Het
Gzma G T 13: 113,098,388 probably null Het
Lhx3 C T 2: 26,201,090 probably benign Het
Mtfr1l T C 4: 134,532,642 probably benign Het
Ndufb4 T C 16: 37,647,670 N126S probably benign Het
Nlrp4e A G 7: 23,321,227 I380V probably benign Het
Nptn A G 9: 58,643,772 K361E probably damaging Het
Olfr262 A G 19: 12,241,139 V174A probably damaging Het
Orc2 T C 1: 58,474,861 D332G probably benign Het
Pcdha4 T C 18: 36,954,789 V675A probably benign Het
Rpl7a-ps3 G A 15: 36,308,283 noncoding transcript Het
Slc13a1 A T 6: 24,092,398 probably null Het
Tec A G 5: 72,782,007 Y222H probably benign Het
Ttll2 T A 17: 7,351,200 R443* probably null Het
Vmn1r66 A T 7: 10,274,788 L106* probably null Het
Zfp189 A G 4: 49,529,934 R346G probably damaging Het
Other mutations in Kng2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00851:Kng2 APN 16 23028830 missense probably damaging 1.00
IGL01319:Kng2 APN 16 23028834 missense probably damaging 0.99
IGL01469:Kng2 APN 16 22999827 missense probably damaging 1.00
IGL01681:Kng2 APN 16 22997017 splice site probably benign
IGL01830:Kng2 APN 16 22988051 missense probably damaging 0.97
IGL01903:Kng2 APN 16 22987790 missense possibly damaging 0.80
IGL02146:Kng2 APN 16 22987832 missense probably damaging 0.97
IGL02305:Kng2 APN 16 23000624 unclassified probably benign
IGL02429:Kng2 APN 16 23012079 missense probably damaging 0.99
FR4548:Kng2 UTSW 16 23000552 nonsense probably null
R0020:Kng2 UTSW 16 22997296 missense probably benign 0.02
R0047:Kng2 UTSW 16 22987563 missense possibly damaging 0.83
R0245:Kng2 UTSW 16 23012181 splice site probably benign
R0610:Kng2 UTSW 16 23000594 missense possibly damaging 0.96
R0646:Kng2 UTSW 16 22987736 missense probably benign 0.10
R0666:Kng2 UTSW 16 22997122 splice site probably benign
R1552:Kng2 UTSW 16 22987520 missense probably damaging 1.00
R1765:Kng2 UTSW 16 22988243 critical splice donor site probably null
R1833:Kng2 UTSW 16 23012052 missense possibly damaging 0.95
R1997:Kng2 UTSW 16 23024876 missense possibly damaging 0.84
R2025:Kng2 UTSW 16 23000575 missense probably benign 0.15
R2056:Kng2 UTSW 16 22987953 intron probably benign
R2137:Kng2 UTSW 16 22997326 intron probably benign
R2517:Kng2 UTSW 16 22988315 missense probably benign 0.24
R3438:Kng2 UTSW 16 23012071 missense probably benign 0.23
R3439:Kng2 UTSW 16 23012071 missense probably benign 0.23
R3551:Kng2 UTSW 16 23011995 critical splice donor site probably null
R4538:Kng2 UTSW 16 22988063 missense probably benign 0.00
R4684:Kng2 UTSW 16 22987641 missense possibly damaging 0.93
R4978:Kng2 UTSW 16 22987916 missense probably damaging 1.00
R5658:Kng2 UTSW 16 22997020 splice site probably null
R6074:Kng2 UTSW 16 23000596 missense probably benign 0.03
R6216:Kng2 UTSW 16 22987593 missense probably damaging 1.00
R6271:Kng2 UTSW 16 23003948 missense probably benign 0.33
R6459:Kng2 UTSW 16 23012115 missense probably damaging 1.00
R7124:Kng2 UTSW 16 23012055 missense probably damaging 1.00
R7310:Kng2 UTSW 16 22987772 missense probably benign 0.00
R7532:Kng2 UTSW 16 23027044 splice site probably null
R7667:Kng2 UTSW 16 22988232 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACACTGCAGATGCCACTG -3'
(R):5'- TCATTCTCACGTCTCACAAGTG -3'

Sequencing Primer
(F):5'- AGATGCCACTGCCACCTTCTAG -3'
(R):5'- CTCACGTCTCACAAGTGGTTAATGG -3'
Posted On2015-07-06