Incidental Mutation 'R4389:Ndufb4'
ID326344
Institutional Source Beutler Lab
Gene Symbol Ndufb4
Ensembl Gene ENSMUSG00000022820
Gene NameNADH dehydrogenase (ubiquinone) 1 beta subcomplex 4
Synonyms
MMRRC Submission 041126-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.871) question?
Stock #R4389 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location37647170-37654453 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37647670 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 126 (N126S)
Ref Sequence ENSEMBL: ENSMUSP00000023514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023514]
Predicted Effect probably benign
Transcript: ENSMUST00000023514
AA Change: N126S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023514
Gene: ENSMUSG00000022820
AA Change: N126S

DomainStartEndE-ValueType
Pfam:NDUF_B4 5 128 5.5e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135019
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.6%
  • 20x: 92.6%
Validation Efficiency 87% (26/30)
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,297,878 T2542P probably damaging Het
Adprm C T 11: 67,038,193 R324K probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cd209b A G 8: 3,925,960 L67P probably damaging Het
Cfap54 T A 10: 92,967,500 K1560M probably benign Het
Ctps T C 4: 120,558,790 D212G probably damaging Het
Ercc6 T A 14: 32,574,908 L1285* probably null Het
Gzma G T 13: 113,098,388 probably null Het
Kng2 T C 16: 23,024,868 I120M possibly damaging Het
Lhx3 C T 2: 26,201,090 probably benign Het
Mtfr1l T C 4: 134,532,642 probably benign Het
Nlrp4e A G 7: 23,321,227 I380V probably benign Het
Nptn A G 9: 58,643,772 K361E probably damaging Het
Olfr262 A G 19: 12,241,139 V174A probably damaging Het
Orc2 T C 1: 58,474,861 D332G probably benign Het
Pcdha4 T C 18: 36,954,789 V675A probably benign Het
Rpl7a-ps3 G A 15: 36,308,283 noncoding transcript Het
Slc13a1 A T 6: 24,092,398 probably null Het
Tec A G 5: 72,782,007 Y222H probably benign Het
Ttll2 T A 17: 7,351,200 R443* probably null Het
Vmn1r66 A T 7: 10,274,788 L106* probably null Het
Zfp189 A G 4: 49,529,934 R346G probably damaging Het
Other mutations in Ndufb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02584:Ndufb4 APN 16 37649170 splice site probably benign
R5345:Ndufb4 UTSW 16 37654178 critical splice donor site probably null
R8252:Ndufb4 UTSW 16 37654275 missense probably benign
R8509:Ndufb4 UTSW 16 37649144 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAACACTCCGTTGCTGACTAACAG -3'
(R):5'- CGAAGTCCTTGGGCTTTAGG -3'

Sequencing Primer
(F):5'- AACAAATGTGTCTTCACTGACC -3'
(R):5'- CTTTAGGAGATGGGCTTACAGTTAC -3'
Posted On2015-07-06