Incidental Mutation 'R4389:Ttll2'
ID326345
Institutional Source Beutler Lab
Gene Symbol Ttll2
Ensembl Gene ENSMUSG00000079722
Gene Nametubulin tyrosine ligase-like family, member 2
SynonymsEG625850
MMRRC Submission 041126-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R4389 (G1)
Quality Score154
Status Not validated
Chromosome17
Chromosomal Location7350885-7352696 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 7351200 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 443 (R443*)
Ref Sequence ENSEMBL: ENSMUSP00000111413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115747] [ENSMUST00000231397]
Predicted Effect probably null
Transcript: ENSMUST00000115747
AA Change: R443*
SMART Domains Protein: ENSMUSP00000111413
Gene: ENSMUSG00000079722
AA Change: R443*

DomainStartEndE-ValueType
Pfam:TTL 91 383 1.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231397
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.6%
  • 20x: 92.6%
Validation Efficiency 87% (26/30)
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,297,878 T2542P probably damaging Het
Adprm C T 11: 67,038,193 R324K probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cd209b A G 8: 3,925,960 L67P probably damaging Het
Cfap54 T A 10: 92,967,500 K1560M probably benign Het
Ctps T C 4: 120,558,790 D212G probably damaging Het
Ercc6 T A 14: 32,574,908 L1285* probably null Het
Gzma G T 13: 113,098,388 probably null Het
Kng2 T C 16: 23,024,868 I120M possibly damaging Het
Lhx3 C T 2: 26,201,090 probably benign Het
Mtfr1l T C 4: 134,532,642 probably benign Het
Ndufb4 T C 16: 37,647,670 N126S probably benign Het
Nlrp4e A G 7: 23,321,227 I380V probably benign Het
Nptn A G 9: 58,643,772 K361E probably damaging Het
Olfr262 A G 19: 12,241,139 V174A probably damaging Het
Orc2 T C 1: 58,474,861 D332G probably benign Het
Pcdha4 T C 18: 36,954,789 V675A probably benign Het
Rpl7a-ps3 G A 15: 36,308,283 noncoding transcript Het
Slc13a1 A T 6: 24,092,398 probably null Het
Tec A G 5: 72,782,007 Y222H probably benign Het
Vmn1r66 A T 7: 10,274,788 L106* probably null Het
Zfp189 A G 4: 49,529,934 R346G probably damaging Het
Other mutations in Ttll2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02071:Ttll2 APN 17 7351731 missense probably damaging 1.00
IGL03190:Ttll2 APN 17 7351380 missense probably benign 0.05
R1922:Ttll2 UTSW 17 7352390 missense probably damaging 0.99
R2237:Ttll2 UTSW 17 7352123 missense probably benign 0.03
R2892:Ttll2 UTSW 17 7352699 splice site probably null
R4388:Ttll2 UTSW 17 7351200 nonsense probably null
R4534:Ttll2 UTSW 17 7351721 missense probably benign 0.02
R4535:Ttll2 UTSW 17 7351721 missense probably benign 0.02
R4536:Ttll2 UTSW 17 7351721 missense probably benign 0.02
R4868:Ttll2 UTSW 17 7351599 missense probably benign 0.07
R4870:Ttll2 UTSW 17 7351599 missense probably benign 0.07
R4871:Ttll2 UTSW 17 7351599 missense probably benign 0.07
R5990:Ttll2 UTSW 17 7352367 missense possibly damaging 0.95
R6145:Ttll2 UTSW 17 7351632 missense probably benign 0.08
R6332:Ttll2 UTSW 17 7351768 missense probably damaging 1.00
R7893:Ttll2 UTSW 17 7352091 missense probably benign 0.15
R8250:Ttll2 UTSW 17 7351368 missense probably benign 0.00
RF010:Ttll2 UTSW 17 7351338 missense probably benign 0.05
Z1088:Ttll2 UTSW 17 7351526 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTCTGAAAGTAGCCTTGTTG -3'
(R):5'- TTCTCCAGGAAACTCCGTGG -3'

Sequencing Primer
(F):5'- CTCTGAAAGTAGCCTTGTTGAACGG -3'
(R):5'- AGGAAACTCCGTGGTCTCC -3'
Posted On2015-07-06