Incidental Mutation 'R4389:Olfr262'
ID326347
Institutional Source Beutler Lab
Gene Symbol Olfr262
Ensembl Gene ENSMUSG00000067519
Gene Nameolfactory receptor 262
SynonymsMOR214-1, GA_x6K02T2N4A9-18144-19082, MOR214-9
MMRRC Submission 041126-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R4389 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location12240721-12241659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12241139 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 174 (V174A)
Ref Sequence ENSEMBL: ENSMUSP00000085120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087818]
Predicted Effect probably damaging
Transcript: ENSMUST00000087818
AA Change: V174A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000085120
Gene: ENSMUSG00000067519
AA Change: V174A

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 2.3e-55 PFAM
Pfam:7tm_1 42 291 1.2e-20 PFAM
Meta Mutation Damage Score 0.2070 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.6%
  • 20x: 92.6%
Validation Efficiency 87% (26/30)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,297,878 T2542P probably damaging Het
Adprm C T 11: 67,038,193 R324K probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cd209b A G 8: 3,925,960 L67P probably damaging Het
Cfap54 T A 10: 92,967,500 K1560M probably benign Het
Ctps T C 4: 120,558,790 D212G probably damaging Het
Ercc6 T A 14: 32,574,908 L1285* probably null Het
Gzma G T 13: 113,098,388 probably null Het
Kng2 T C 16: 23,024,868 I120M possibly damaging Het
Lhx3 C T 2: 26,201,090 probably benign Het
Mtfr1l T C 4: 134,532,642 probably benign Het
Ndufb4 T C 16: 37,647,670 N126S probably benign Het
Nlrp4e A G 7: 23,321,227 I380V probably benign Het
Nptn A G 9: 58,643,772 K361E probably damaging Het
Orc2 T C 1: 58,474,861 D332G probably benign Het
Pcdha4 T C 18: 36,954,789 V675A probably benign Het
Rpl7a-ps3 G A 15: 36,308,283 noncoding transcript Het
Slc13a1 A T 6: 24,092,398 probably null Het
Tec A G 5: 72,782,007 Y222H probably benign Het
Ttll2 T A 17: 7,351,200 R443* probably null Het
Vmn1r66 A T 7: 10,274,788 L106* probably null Het
Zfp189 A G 4: 49,529,934 R346G probably damaging Het
Other mutations in Olfr262
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Olfr262 APN 19 12241527 missense probably damaging 0.99
IGL02170:Olfr262 APN 19 12240756 missense probably benign
IGL02748:Olfr262 APN 19 12240840 missense probably benign 0.01
IGL02896:Olfr262 APN 19 12240989 nonsense probably null
R0365:Olfr262 UTSW 19 12241076 missense probably benign 0.13
R0374:Olfr262 UTSW 19 12241141 missense probably damaging 1.00
R1226:Olfr262 UTSW 19 12241586 missense probably benign
R1319:Olfr262 UTSW 19 12241502 missense probably damaging 1.00
R1426:Olfr262 UTSW 19 12241182 missense possibly damaging 0.81
R1453:Olfr262 UTSW 19 12241592 missense probably benign
R1675:Olfr262 UTSW 19 12240831 missense probably benign 0.37
R1773:Olfr262 UTSW 19 12241659 start codon destroyed probably null 0.03
R1778:Olfr262 UTSW 19 12241455 missense probably benign
R1820:Olfr262 UTSW 19 12241248 missense probably damaging 1.00
R3161:Olfr262 UTSW 19 12241496 missense probably benign 0.06
R3412:Olfr262 UTSW 19 12241590 missense probably benign 0.00
R4387:Olfr262 UTSW 19 12241139 missense probably damaging 0.98
R4782:Olfr262 UTSW 19 12241572 missense probably benign 0.01
R4885:Olfr262 UTSW 19 12240718 splice site probably null
R4915:Olfr262 UTSW 19 12241373 missense probably benign 0.31
R5254:Olfr262 UTSW 19 12241248 missense probably damaging 1.00
R5726:Olfr262 UTSW 19 12241280 missense probably damaging 0.99
R6579:Olfr262 UTSW 19 12241362 missense probably benign
R7062:Olfr262 UTSW 19 12240725 missense probably benign
R7424:Olfr262 UTSW 19 12240954 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- GAAGCACAGGTGTTGAATGCC -3'
(R):5'- AGTGAGTCTTGTCTCATGGC -3'

Sequencing Primer
(F):5'- TGCCCTTAGCTGAAGTGATC -3'
(R):5'- GCAGCCATGGCCTATGAC -3'
Posted On2015-07-06