Incidental Mutation 'R4391:Stmn3'
ID 326357
Institutional Source Beutler Lab
Gene Symbol Stmn3
Ensembl Gene ENSMUSG00000027581
Gene Name stathmin-like 3
Synonyms Sclip, 9330161A03Rik
MMRRC Submission 041682-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.271) question?
Stock # R4391 (G1)
Quality Score 202
Status Validated
Chromosome 2
Chromosomal Location 180948252-180956293 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 180950576 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 77 (R77G)
Ref Sequence ENSEMBL: ENSMUSP00000099334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103045]
AlphaFold O70166
Predicted Effect probably benign
Transcript: ENSMUST00000103045
AA Change: R77G

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099334
Gene: ENSMUSG00000027581
AA Change: R77G

DomainStartEndE-ValueType
Pfam:Stathmin 41 175 2.7e-56 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.6%
  • 10x: 96.4%
  • 20x: 91.6%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a member of the stathmin protein family. Members of this protein family form a complex with tubulins at a ratio of 2 tubulins for each stathmin protein. Microtubules require the ordered assembly of alpha- and beta-tubulins, and formation of a complex with stathmin disrupts microtubule formation and function. A pseudogene of this gene is located on chromosome 22. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030469F06Rik A T 12: 31,234,622 (GRCm39) noncoding transcript Het
Actn2 C T 13: 12,305,634 (GRCm39) R394Q probably damaging Het
Atg16l1 A G 1: 87,687,842 (GRCm39) D62G probably damaging Het
Atp2b1 A G 10: 98,839,076 (GRCm39) T635A probably benign Het
Chil4 G A 3: 106,111,043 (GRCm39) P284S possibly damaging Het
Dnah1 G A 14: 31,016,792 (GRCm39) T1575I probably damaging Het
Dnah7b A G 1: 46,376,754 (GRCm39) probably null Het
Dnajc12 A G 10: 63,242,838 (GRCm39) T37A probably benign Het
Efcab5 T A 11: 76,981,284 (GRCm39) N1354I probably damaging Het
Epas1 T C 17: 87,117,091 (GRCm39) L218P probably benign Het
Fbxw15 T A 9: 109,397,300 (GRCm39) probably benign Het
Filip1l C A 16: 57,391,155 (GRCm39) S581* probably null Het
Focad T A 4: 88,104,195 (GRCm39) I358K probably damaging Het
Gm382 T A X: 125,968,942 (GRCm39) S376T probably benign Het
Gpsm1 C T 2: 26,214,009 (GRCm39) R179C probably damaging Het
Hjurp A G 1: 88,194,283 (GRCm39) probably benign Het
Homer3 G A 8: 70,742,793 (GRCm39) probably null Het
Krt39 C T 11: 99,405,578 (GRCm39) A441T probably benign Het
Nrdc T A 4: 108,903,841 (GRCm39) N662K probably damaging Het
Obox5 C T 7: 15,491,899 (GRCm39) Q105* probably null Het
Or56a3b T A 7: 104,770,793 (GRCm39) M43K possibly damaging Het
Or5af1 T A 11: 58,722,841 (GRCm39) V287D possibly damaging Het
Or8c13 A T 9: 38,091,645 (GRCm39) V158D probably damaging Het
Pcdhb5 T A 18: 37,455,789 (GRCm39) L723Q possibly damaging Het
Pou3f3 G T 1: 42,736,618 (GRCm39) A105S unknown Het
Ppp1r3d C T 2: 178,055,880 (GRCm39) D41N probably damaging Het
Ppp4r1 A G 17: 66,131,749 (GRCm39) N497S probably benign Het
Rad54b T G 4: 11,615,570 (GRCm39) N859K probably benign Het
Sh3bp2 C T 5: 34,707,062 (GRCm39) S29L probably benign Het
Smarcad1 A T 6: 65,033,443 (GRCm39) N142I probably benign Het
Sp140l1 G A 1: 85,062,852 (GRCm39) probably benign Het
Stat3 G A 11: 100,796,378 (GRCm39) probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,139,706 (GRCm39) probably benign Het
Vmn2r79 A G 7: 86,651,099 (GRCm39) H166R possibly damaging Het
Xlr3a T C X: 72,135,450 (GRCm39) I87V possibly damaging Het
Other mutations in Stmn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
Translucent UTSW 2 180,950,573 (GRCm39) missense possibly damaging 0.81
IGL03147:Stmn3 UTSW 2 180,950,993 (GRCm39) missense possibly damaging 0.63
R1916:Stmn3 UTSW 2 180,949,073 (GRCm39) missense possibly damaging 0.86
R4113:Stmn3 UTSW 2 180,949,089 (GRCm39) missense possibly damaging 0.87
R4910:Stmn3 UTSW 2 180,950,630 (GRCm39) missense probably damaging 0.99
R5903:Stmn3 UTSW 2 180,950,573 (GRCm39) missense possibly damaging 0.81
R6047:Stmn3 UTSW 2 180,950,952 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCCCTCAAGAATGTGGTTCC -3'
(R):5'- ATCCTGCCTGTATGCCCAAAC -3'

Sequencing Primer
(F):5'- AAGAATGTGGTTCCTATTGCCC -3'
(R):5'- GCCCAAACCAGGCCTCC -3'
Posted On 2015-07-06