Mutagenetix > Incidental Mutation

Incidental Mutation 'R4391:Rad54b'

326359

Institutional Source

Beutler Lab

Gene Symbol

Rad54b

Ensembl Gene

ENSMUSG00000078773

Gene Name

RAD54 homolog B (S. cerevisiae)

Synonyms

E130016E03Rik, E130016E03Rik

MMRRC Submission

041682-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4391 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

11558922-11615805 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 11615570 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 859 (N859K)

Ref Sequence

ENSEMBL: ENSMUSP00000066977 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070755]

AlphaFold

Q6PFE3

Predicted Effect

probably benign
Transcript: ENSMUST00000070755
AA Change: N859K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000066977
Gene: ENSMUSG00000078773
AA Change: N859K

Domain	Start	End	E-Value	Type
low complexity region	113	121	N/A	INTRINSIC
low complexity region	164	178	N/A	INTRINSIC
DEXDc	270	470	4.36e-36	SMART
HELICc	652	736	6.14e-22	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144499

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148576

Meta Mutation Damage Score

0.1004

Coding Region Coverage

1x: 99.6%
3x: 98.6%
10x: 96.4%
20x: 91.6%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the DEAD-like helicase superfamily. It shares similarity with Saccharomyces cerevisiae RAD54 and RDH54, both of which are involved in homologous recombination and repair of DNA. This protein binds to double-stranded DNA, and displays ATPase activity in the presence of DNA. This gene is highly expressed in testis and spleen, which suggests active roles in meiotic and mitotic recombination. Homozygous mutations of this gene were observed in primary lymphoma and colon cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have an increased sensitivity to ionizing radiation and other agents of DNA damage but outherwise have a normal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6030469F06Rik	A	T	12: 31,184,623		noncoding transcript	Het
A530032D15Rik	G	A	1: 85,085,131		probably benign	Het
Actn2	C	T	13: 12,290,748	R394Q	probably damaging	Het
Atg16l1	A	G	1: 87,760,120	D62G	probably damaging	Het
Atp2b1	A	G	10: 99,003,214	T635A	probably benign	Het
Chil4	G	A	3: 106,203,727	P284S	possibly damaging	Het
Dnah1	G	A	14: 31,294,835	T1575I	probably damaging	Het
Dnah7b	A	G	1: 46,337,594		probably null	Het
Dnajc12	A	G	10: 63,407,059	T37A	probably benign	Het
Efcab5	T	A	11: 77,090,458	N1354I	probably damaging	Het
Epas1	T	C	17: 86,809,663	L218P	probably benign	Het
Fbxw15	T	A	9: 109,568,232		probably benign	Het
Filip1l	C	A	16: 57,570,792	S581*	probably null	Het
Focad	T	A	4: 88,185,958	I358K	probably damaging	Het
Gm382	T	A	X: 127,061,319	S376T	probably benign	Het
Gpsm1	C	T	2: 26,323,997	R179C	probably damaging	Het
Hjurp	A	G	1: 88,266,561		probably benign	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Krt39	C	T	11: 99,514,752	A441T	probably benign	Het
Nrd1	T	A	4: 109,046,644	N662K	probably damaging	Het
Obox5	C	T	7: 15,757,974	Q105*	probably null	Het
Olfr312	T	A	11: 58,832,015	V287D	possibly damaging	Het
Olfr681	T	A	7: 105,121,586	M43K	possibly damaging	Het
Olfr891	A	T	9: 38,180,349	V158D	probably damaging	Het
Pcdhb5	T	A	18: 37,322,736	L723Q	possibly damaging	Het
Pou3f3	G	T	1: 42,697,458	A105S	unknown	Het
Ppp1r3d	C	T	2: 178,414,087	D41N	probably damaging	Het
Ppp4r1	A	G	17: 65,824,754	N497S	probably benign	Het
Sh3bp2	C	T	5: 34,549,718	S29L	probably benign	Het
Smarcad1	A	T	6: 65,056,459	N142I	probably benign	Het
Stat3	G	A	11: 100,905,552		probably benign	Het
Stmn3	T	C	2: 181,308,783	R77G	probably benign	Het
Ugt1a1	CAGAGAGAGAGAGA	CAGAGAGAGAGA	1: 88,211,984		probably benign	Het
Vmn2r79	A	G	7: 87,001,891	H166R	possibly damaging	Het
Xlr3a	T	C	X: 73,091,844	I87V	possibly damaging	Het

Other mutations in Rad54b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00770:Rad54b	APN	4	11593765	missense	probably benign
IGL00774:Rad54b	APN	4	11593765	missense	probably benign
IGL00956:Rad54b	APN	4	11597833	missense	probably damaging	0.98
IGL00961:Rad54b	APN	4	11599699	missense	probably damaging	1.00
IGL01064:Rad54b	APN	4	11604866	missense	probably damaging	1.00
IGL02150:Rad54b	APN	4	11610502	missense	probably damaging	1.00
IGL02326:Rad54b	APN	4	11612713	missense	probably damaging	1.00
IGL03105:Rad54b	APN	4	11615569	missense	probably benign	0.00
IGL03143:Rad54b	APN	4	11599755	missense	probably damaging	1.00
IGL03288:Rad54b	APN	4	11569833	missense	possibly damaging	0.83
kerplunk	UTSW	4	11612655	missense	probably damaging	1.00
Schnipfel	UTSW	4	11583689	unclassified	probably benign
P0033:Rad54b	UTSW	4	11609285	unclassified	probably benign
R0076:Rad54b	UTSW	4	11609480	unclassified	probably benign
R0094:Rad54b	UTSW	4	11599681	missense	possibly damaging	0.92
R0391:Rad54b	UTSW	4	11601702	missense	probably damaging	0.98
R0441:Rad54b	UTSW	4	11563394	missense	probably benign	0.08
R0442:Rad54b	UTSW	4	11609480	unclassified	probably benign
R0442:Rad54b	UTSW	4	11610362	missense	probably benign	0.02
R0449:Rad54b	UTSW	4	11606131	missense	probably benign	0.43
R0519:Rad54b	UTSW	4	11599809	missense	probably damaging	1.00
R0843:Rad54b	UTSW	4	11609471	critical splice donor site	probably null
R1118:Rad54b	UTSW	4	11563352	missense	probably damaging	1.00
R1439:Rad54b	UTSW	4	11606152	missense	possibly damaging	0.90
R1763:Rad54b	UTSW	4	11604989	missense	possibly damaging	0.52
R1812:Rad54b	UTSW	4	11612770	missense	probably damaging	1.00
R1854:Rad54b	UTSW	4	11601669	missense	probably damaging	1.00
R1917:Rad54b	UTSW	4	11601693	missense	probably damaging	1.00
R1918:Rad54b	UTSW	4	11601693	missense	probably damaging	1.00
R1919:Rad54b	UTSW	4	11601693	missense	probably damaging	1.00
R2057:Rad54b	UTSW	4	11606088	missense	probably benign	0.08
R2386:Rad54b	UTSW	4	11597874	missense	probably benign
R2437:Rad54b	UTSW	4	11606272	missense	probably damaging	1.00
R4299:Rad54b	UTSW	4	11597865	missense	probably damaging	1.00
R4672:Rad54b	UTSW	4	11609449	missense	probably benign	0.05
R4673:Rad54b	UTSW	4	11609449	missense	probably benign	0.05
R4826:Rad54b	UTSW	4	11599753	missense	probably damaging	1.00
R4930:Rad54b	UTSW	4	11615579	missense	probably damaging	0.99
R5796:Rad54b	UTSW	4	11615446	missense	probably benign	0.01
R5901:Rad54b	UTSW	4	11595919	missense	possibly damaging	0.84
R6185:Rad54b	UTSW	4	11593804	missense	possibly damaging	0.51
R6355:Rad54b	UTSW	4	11604989	missense	possibly damaging	0.52
R6576:Rad54b	UTSW	4	11601577	missense	probably benign
R6684:Rad54b	UTSW	4	11583689	unclassified	probably benign
R6821:Rad54b	UTSW	4	11612777	missense	probably damaging	1.00
R6947:Rad54b	UTSW	4	11569859	missense	possibly damaging	0.83
R7177:Rad54b	UTSW	4	11599755	missense	probably damaging	1.00
R7361:Rad54b	UTSW	4	11599782	missense	probably damaging	1.00
R7483:Rad54b	UTSW	4	11610372	missense	probably damaging	1.00
R7511:Rad54b	UTSW	4	11578956	splice site	probably null
R7847:Rad54b	UTSW	4	11612655	missense	probably damaging	1.00
R7908:Rad54b	UTSW	4	11595868	missense	probably null	0.01
R8198:Rad54b	UTSW	4	11612440	critical splice donor site	probably null
R9140:Rad54b	UTSW	4	11610386	missense	probably damaging	1.00
R9213:Rad54b	UTSW	4	11609321	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TATCTGCTTCCCAAAGAGTCTC -3'
(R):5'- CGGCACATGGTTAACGGTTC -3'

Sequencing Primer
(F):5'- CTCACTGTTTAACTCATTGCAGAGG -3'
(R):5'- GCACATGGTTAACGGTTCATTTC -3'

Posted On

2015-07-06