Mutagenetix > Incidental Mutations

Incidental Mutation 'R4391:Focad'

326360

Institutional Source

Beutler Lab

Gene Symbol

Focad

Ensembl Gene

ENSMUSG00000038368

Gene Name

focadhesin

Synonyms

BC057079

MMRRC Submission

041682-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.484) question?

Stock #

R4391 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

88094629-88411011 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 88185958 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 358 (I358K)

Ref Sequence

ENSEMBL: ENSMUSP00000124298 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097992] [ENSMUST00000159342]

Predicted Effect

unknown
Transcript: ENSMUST00000097992
AA Change: I358K

SMART Domains

Protein: ENSMUSP00000095602
Gene: ENSMUSG00000038368
AA Change: I358K

Domain	Start	End	E-Value	Type
low complexity region	150	161	N/A	INTRINSIC
low complexity region	194	203	N/A	INTRINSIC
low complexity region	264	273	N/A	INTRINSIC
low complexity region	328	338	N/A	INTRINSIC
low complexity region	348	361	N/A	INTRINSIC
Pfam:DUF3730	490	714	1.5e-71	PFAM
low complexity region	957	969	N/A	INTRINSIC
low complexity region	1032	1047	N/A	INTRINSIC
low complexity region	1200	1209	N/A	INTRINSIC
Pfam:DUF3028	1210	1798	1.5e-291	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000159342
AA Change: I358K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124298
Gene: ENSMUSG00000038368
AA Change: I358K

Domain	Start	End	E-Value	Type
Pfam:DUF3730	20	250	5.8e-27	PFAM
low complexity region	264	273	N/A	INTRINSIC
low complexity region	328	338	N/A	INTRINSIC
low complexity region	348	361	N/A	INTRINSIC
Pfam:DUF3730	403	633	2.8e-61	PFAM
low complexity region	871	883	N/A	INTRINSIC
low complexity region	946	961	N/A	INTRINSIC
low complexity region	1114	1123	N/A	INTRINSIC
Pfam:DUF3028	1124	1712	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161058

Meta Mutation Damage Score

0.5774

Coding Region Coverage

1x: 99.6%
3x: 98.6%
10x: 96.4%
20x: 91.6%

Validation Efficiency

100% (40/40)

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6030469F06Rik	A	T	12: 31,184,623		noncoding transcript	Het
A530032D15Rik	G	A	1: 85,085,131		probably benign	Het
Actn2	C	T	13: 12,290,748	R394Q	probably damaging	Het
Atg16l1	A	G	1: 87,760,120	D62G	probably damaging	Het
Atp2b1	A	G	10: 99,003,214	T635A	probably benign	Het
Chil4	G	A	3: 106,203,727	P284S	possibly damaging	Het
Dnah1	G	A	14: 31,294,835	T1575I	probably damaging	Het
Dnah7b	A	G	1: 46,337,594		probably null	Het
Dnajc12	A	G	10: 63,407,059	T37A	probably benign	Het
Efcab5	T	A	11: 77,090,458	N1354I	probably damaging	Het
Epas1	T	C	17: 86,809,663	L218P	probably benign	Het
Fbxw15	T	A	9: 109,568,232		probably benign	Het
Filip1l	C	A	16: 57,570,792	S581*	probably null	Het
Gm382	T	A	X: 127,061,319	S376T	probably benign	Het
Gpsm1	C	T	2: 26,323,997	R179C	probably damaging	Het
Hjurp	A	G	1: 88,266,561		probably benign	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Krt39	C	T	11: 99,514,752	A441T	probably benign	Het
Nrd1	T	A	4: 109,046,644	N662K	probably damaging	Het
Obox5	C	T	7: 15,757,974	Q105*	probably null	Het
Olfr312	T	A	11: 58,832,015	V287D	possibly damaging	Het
Olfr681	T	A	7: 105,121,586	M43K	possibly damaging	Het
Olfr891	A	T	9: 38,180,349	V158D	probably damaging	Het
Pcdhb5	T	A	18: 37,322,736	L723Q	possibly damaging	Het
Pou3f3	G	T	1: 42,697,458	A105S	unknown	Het
Ppp1r3d	C	T	2: 178,414,087	D41N	probably damaging	Het
Ppp4r1	A	G	17: 65,824,754	N497S	probably benign	Het
Rad54b	T	G	4: 11,615,570	N859K	probably benign	Het
Sh3bp2	C	T	5: 34,549,718	S29L	probably benign	Het
Smarcad1	A	T	6: 65,056,459	N142I	probably benign	Het
Stat3	G	A	11: 100,905,552		probably benign	Het
Stmn3	T	C	2: 181,308,783	R77G	probably benign	Het
Ugt1a1	CAGAGAGAGAGAGA	CAGAGAGAGAGA	1: 88,211,984		probably benign	Het
Vmn2r79	A	G	7: 87,001,891	H166R	possibly damaging	Het
Xlr3a	T	C	X: 73,091,844	I87V	possibly damaging	Het

Other mutations in Focad

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00326:Focad	APN	4	88357474	missense	unknown
IGL00562:Focad	APN	4	88348809	missense	unknown
IGL00563:Focad	APN	4	88348809	missense	unknown
IGL00900:Focad	APN	4	88129023	missense	probably damaging	0.99
IGL00984:Focad	APN	4	88344785	missense	unknown
IGL01016:Focad	APN	4	88392015	missense	possibly damaging	0.51
IGL01069:Focad	APN	4	88326146	missense	unknown
IGL01305:Focad	APN	4	88393547	missense	probably benign	0.32
IGL01409:Focad	APN	4	88342305	missense	unknown
IGL01447:Focad	APN	4	88326228	missense	unknown
IGL01521:Focad	APN	4	88410690	makesense	probably null
IGL01672:Focad	APN	4	88360590	critical splice donor site	probably null
IGL01739:Focad	APN	4	88370806	missense	unknown
IGL02082:Focad	APN	4	88230578	nonsense	probably null
IGL02139:Focad	APN	4	88129054	critical splice donor site	probably null
IGL02381:Focad	APN	4	88274090	splice site	probably benign
IGL02898:Focad	APN	4	88391997	missense	probably benign	0.02
Microscope	UTSW	4	88342204	missense	unknown
Objective	UTSW	4	88401068	nonsense	probably null
ANU22:Focad	UTSW	4	88393547	missense	probably benign	0.32
R0025:Focad	UTSW	4	88408959	missense	probably benign	0.02
R0554:Focad	UTSW	4	88348889	missense	unknown
R0617:Focad	UTSW	4	88121288	unclassified	probably benign
R0688:Focad	UTSW	4	88274213	missense	unknown
R0746:Focad	UTSW	4	88397214	missense	possibly damaging	0.84
R0907:Focad	UTSW	4	88278261	critical splice donor site	probably null
R1109:Focad	UTSW	4	88196747	intron	probably benign
R1136:Focad	UTSW	4	88326180	missense	unknown
R1185:Focad	UTSW	4	88178187	missense	probably benign	0.40
R1185:Focad	UTSW	4	88178187	missense	probably benign	0.40
R1185:Focad	UTSW	4	88178187	missense	probably benign	0.40
R1412:Focad	UTSW	4	88278261	critical splice donor site	probably null
R1453:Focad	UTSW	4	88357442	critical splice acceptor site	probably null
R1697:Focad	UTSW	4	88408988	missense	probably damaging	0.98
R1739:Focad	UTSW	4	88397891	missense	probably benign	0.05
R1767:Focad	UTSW	4	88357468	missense	unknown
R1827:Focad	UTSW	4	88229383	missense	probably benign	0.03
R1866:Focad	UTSW	4	88407165	missense	possibly damaging	0.92
R1867:Focad	UTSW	4	88178089	missense	probably damaging	0.99
R1929:Focad	UTSW	4	88342212	missense	unknown
R1929:Focad	UTSW	4	88397179	missense	probably benign	0.32
R1937:Focad	UTSW	4	88401081	start codon destroyed	probably null
R1989:Focad	UTSW	4	88232784	critical splice donor site	probably null
R2176:Focad	UTSW	4	88279244	missense	unknown
R2393:Focad	UTSW	4	88121330	missense	probably damaging	0.96
R2431:Focad	UTSW	4	88331027	missense	unknown
R3195:Focad	UTSW	4	88407351	missense	possibly damaging	0.85
R3196:Focad	UTSW	4	88407351	missense	possibly damaging	0.85
R3730:Focad	UTSW	4	88408925	missense	possibly damaging	0.52
R3772:Focad	UTSW	4	88336161	splice site	probably benign
R4491:Focad	UTSW	4	88359905	critical splice donor site	probably null
R4492:Focad	UTSW	4	88359905	critical splice donor site	probably null
R4703:Focad	UTSW	4	88342321	critical splice donor site	probably null
R4788:Focad	UTSW	4	88357469	missense	unknown
R4923:Focad	UTSW	4	88196846	intron	probably benign
R5026:Focad	UTSW	4	88344582	missense	unknown
R5122:Focad	UTSW	4	88407365	critical splice donor site	probably null
R5153:Focad	UTSW	4	88359884	missense	unknown
R5369:Focad	UTSW	4	88121373	splice site	probably benign
R5414:Focad	UTSW	4	88410702	utr 3 prime	probably benign
R5839:Focad	UTSW	4	88196846	intron	probably benign
R5916:Focad	UTSW	4	88357541	missense	unknown
R5953:Focad	UTSW	4	88229335	missense	probably benign	0.01
R5991:Focad	UTSW	4	88401019	missense	possibly damaging	0.91
R6230:Focad	UTSW	4	88342204	missense	unknown
R6247:Focad	UTSW	4	88407140	missense	possibly damaging	0.92
R6324:Focad	UTSW	4	88401068	nonsense	probably null
R6543:Focad	UTSW	4	88279256	missense	unknown
R6639:Focad	UTSW	4	88278242	missense	unknown
R6802:Focad	UTSW	4	88274203	missense	unknown
R6802:Focad	UTSW	4	88344684	missense	unknown
R6866:Focad	UTSW	4	88403386	missense	probably benign	0.34
R6902:Focad	UTSW	4	88230476	missense	unknown
R6928:Focad	UTSW	4	88348875	missense	unknown
R7036:Focad	UTSW	4	88124637	missense	probably benign	0.05
R7057:Focad	UTSW	4	88274105	missense	unknown
R7077:Focad	UTSW	4	88410677	missense	unknown
R7242:Focad	UTSW	4	88309906	missense	unknown
R7357:Focad	UTSW	4	88229335	missense	probably benign	0.19
R7380:Focad	UTSW	4	88274198	missense	unknown
R7427:Focad	UTSW	4	88368751	missense	unknown
R7582:Focad	UTSW	4	88229378	missense	probably benign	0.00
R7661:Focad	UTSW	4	88303535	missense	unknown
R7688:Focad	UTSW	4	88178133	missense	probably damaging	1.00
R7789:Focad	UTSW	4	88229406	missense	unknown
R7880:Focad	UTSW	4	88401170	missense	unknown
R7887:Focad	UTSW	4	88182616	missense	probably damaging	1.00
R7963:Focad	UTSW	4	88401170	missense	unknown
R7970:Focad	UTSW	4	88182616	missense	probably damaging	1.00
X0035:Focad	UTSW	4	88397922	missense	possibly damaging	0.86

Predicted Primers

PCR Primer
(F):5'- AGCTGGTTGTAAATGTGCAAG -3'
(R):5'- TAGTCCAGAGCAGCATAACATC -3'

Sequencing Primer
(F):5'- GCAAGAAAAACTCTATTTCATGGGG -3'
(R):5'- GTACAGTGAACTTACATTGAAGCAG -3'

Posted On

2015-07-06