Incidental Mutation 'R4391:Smarcad1'
ID 326362
Institutional Source Beutler Lab
Gene Symbol Smarcad1
Ensembl Gene ENSMUSG00000029920
Gene Name SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1
Synonyms Etl1, D6Pas1
MMRRC Submission 041682-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.303) question?
Stock # R4391 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 65019577-65093045 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 65033443 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 142 (N142I)
Ref Sequence ENSEMBL: ENSMUSP00000031984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031984] [ENSMUST00000204114] [ENSMUST00000204620] [ENSMUST00000204801] [ENSMUST00000204955]
AlphaFold Q04692
Predicted Effect probably benign
Transcript: ENSMUST00000031984
AA Change: N142I

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000031984
Gene: ENSMUSG00000029920
AA Change: N142I

DomainStartEndE-ValueType
low complexity region 17 37 N/A INTRINSIC
low complexity region 39 53 N/A INTRINSIC
low complexity region 143 156 N/A INTRINSIC
low complexity region 210 224 N/A INTRINSIC
low complexity region 233 244 N/A INTRINSIC
low complexity region 333 348 N/A INTRINSIC
DEXDc 488 682 2.58e-38 SMART
Blast:DEXDc 685 745 4e-16 BLAST
HELICc 879 962 4.58e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203756
Predicted Effect probably benign
Transcript: ENSMUST00000204114
SMART Domains Protein: ENSMUSP00000145228
Gene: ENSMUSG00000029920

DomainStartEndE-ValueType
low complexity region 17 37 N/A INTRINSIC
low complexity region 39 53 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204420
Predicted Effect probably benign
Transcript: ENSMUST00000204620
SMART Domains Protein: ENSMUSP00000144767
Gene: ENSMUSG00000029920

DomainStartEndE-ValueType
low complexity region 17 37 N/A INTRINSIC
low complexity region 39 53 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204801
SMART Domains Protein: ENSMUSP00000145195
Gene: ENSMUSG00000029920

DomainStartEndE-ValueType
low complexity region 17 37 N/A INTRINSIC
low complexity region 39 53 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204955
SMART Domains Protein: ENSMUSP00000145152
Gene: ENSMUSG00000029920

DomainStartEndE-ValueType
low complexity region 17 37 N/A INTRINSIC
low complexity region 39 53 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205092
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.6%
  • 10x: 96.4%
  • 20x: 91.6%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SNF subfamily of helicase proteins. The encoded protein plays a critical role in the restoration of heterochromatin organization and propagation of epigenetic patterns following DNA replication by mediating histone H3/H4 deacetylation. Mutations in this gene are associated with adermatoglyphia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit retarded growth, impaired fertility, skeletal dysplasias, and peri- and postnatal lethality. Mutant phenotypes are influenced by genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(258) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(256)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030469F06Rik A T 12: 31,234,622 (GRCm39) noncoding transcript Het
Actn2 C T 13: 12,305,634 (GRCm39) R394Q probably damaging Het
Atg16l1 A G 1: 87,687,842 (GRCm39) D62G probably damaging Het
Atp2b1 A G 10: 98,839,076 (GRCm39) T635A probably benign Het
Chil4 G A 3: 106,111,043 (GRCm39) P284S possibly damaging Het
Dnah1 G A 14: 31,016,792 (GRCm39) T1575I probably damaging Het
Dnah7b A G 1: 46,376,754 (GRCm39) probably null Het
Dnajc12 A G 10: 63,242,838 (GRCm39) T37A probably benign Het
Efcab5 T A 11: 76,981,284 (GRCm39) N1354I probably damaging Het
Epas1 T C 17: 87,117,091 (GRCm39) L218P probably benign Het
Fbxw15 T A 9: 109,397,300 (GRCm39) probably benign Het
Filip1l C A 16: 57,391,155 (GRCm39) S581* probably null Het
Focad T A 4: 88,104,195 (GRCm39) I358K probably damaging Het
Gm382 T A X: 125,968,942 (GRCm39) S376T probably benign Het
Gpsm1 C T 2: 26,214,009 (GRCm39) R179C probably damaging Het
Hjurp A G 1: 88,194,283 (GRCm39) probably benign Het
Homer3 G A 8: 70,742,793 (GRCm39) probably null Het
Krt39 C T 11: 99,405,578 (GRCm39) A441T probably benign Het
Nrdc T A 4: 108,903,841 (GRCm39) N662K probably damaging Het
Obox5 C T 7: 15,491,899 (GRCm39) Q105* probably null Het
Or56a3b T A 7: 104,770,793 (GRCm39) M43K possibly damaging Het
Or5af1 T A 11: 58,722,841 (GRCm39) V287D possibly damaging Het
Or8c13 A T 9: 38,091,645 (GRCm39) V158D probably damaging Het
Pcdhb5 T A 18: 37,455,789 (GRCm39) L723Q possibly damaging Het
Pou3f3 G T 1: 42,736,618 (GRCm39) A105S unknown Het
Ppp1r3d C T 2: 178,055,880 (GRCm39) D41N probably damaging Het
Ppp4r1 A G 17: 66,131,749 (GRCm39) N497S probably benign Het
Rad54b T G 4: 11,615,570 (GRCm39) N859K probably benign Het
Sh3bp2 C T 5: 34,707,062 (GRCm39) S29L probably benign Het
Sp140l1 G A 1: 85,062,852 (GRCm39) probably benign Het
Stat3 G A 11: 100,796,378 (GRCm39) probably benign Het
Stmn3 T C 2: 180,950,576 (GRCm39) R77G probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,139,706 (GRCm39) probably benign Het
Vmn2r79 A G 7: 86,651,099 (GRCm39) H166R possibly damaging Het
Xlr3a T C X: 72,135,450 (GRCm39) I87V possibly damaging Het
Other mutations in Smarcad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02318:Smarcad1 APN 6 65,050,223 (GRCm39) missense probably damaging 1.00
IGL02707:Smarcad1 APN 6 65,029,790 (GRCm39) unclassified probably benign
IGL03006:Smarcad1 APN 6 65,060,873 (GRCm39) missense probably benign 0.01
IGL03131:Smarcad1 APN 6 65,051,937 (GRCm39) missense probably damaging 0.96
IGL03406:Smarcad1 APN 6 65,069,510 (GRCm39) missense probably damaging 0.98
Trollip UTSW 6 65,091,320 (GRCm39) missense probably damaging 1.00
wastrel UTSW 6 65,029,654 (GRCm39) missense probably damaging 1.00
N/A - 293:Smarcad1 UTSW 6 65,051,898 (GRCm39) missense probably benign 0.06
R0020:Smarcad1 UTSW 6 65,060,991 (GRCm39) splice site probably benign
R0452:Smarcad1 UTSW 6 65,051,806 (GRCm39) missense possibly damaging 0.66
R1005:Smarcad1 UTSW 6 65,085,711 (GRCm39) missense probably benign 0.30
R1143:Smarcad1 UTSW 6 65,073,678 (GRCm39) missense probably benign 0.02
R1624:Smarcad1 UTSW 6 65,029,631 (GRCm39) missense probably benign 0.40
R1629:Smarcad1 UTSW 6 65,044,091 (GRCm39) missense probably benign 0.00
R1705:Smarcad1 UTSW 6 65,033,400 (GRCm39) missense probably damaging 1.00
R2000:Smarcad1 UTSW 6 65,050,200 (GRCm39) missense probably damaging 1.00
R2979:Smarcad1 UTSW 6 65,051,995 (GRCm39) missense probably benign 0.00
R3937:Smarcad1 UTSW 6 65,091,320 (GRCm39) missense probably damaging 1.00
R4648:Smarcad1 UTSW 6 65,044,073 (GRCm39) missense probably benign 0.04
R4697:Smarcad1 UTSW 6 65,029,625 (GRCm39) missense probably benign 0.00
R4709:Smarcad1 UTSW 6 65,052,099 (GRCm39) missense probably benign 0.01
R4726:Smarcad1 UTSW 6 65,052,025 (GRCm39) missense probably damaging 1.00
R4776:Smarcad1 UTSW 6 65,075,808 (GRCm39) missense probably null 1.00
R4928:Smarcad1 UTSW 6 65,051,898 (GRCm39) missense probably benign 0.06
R5619:Smarcad1 UTSW 6 65,088,865 (GRCm39) missense probably benign 0.03
R5709:Smarcad1 UTSW 6 65,051,746 (GRCm39) missense probably benign 0.01
R6038:Smarcad1 UTSW 6 65,050,232 (GRCm39) missense possibly damaging 0.91
R6038:Smarcad1 UTSW 6 65,050,232 (GRCm39) missense possibly damaging 0.91
R6220:Smarcad1 UTSW 6 65,091,313 (GRCm39) missense probably benign 0.09
R6302:Smarcad1 UTSW 6 65,052,122 (GRCm39) missense possibly damaging 0.93
R7014:Smarcad1 UTSW 6 65,029,654 (GRCm39) missense probably damaging 1.00
R7149:Smarcad1 UTSW 6 65,029,716 (GRCm39) missense probably benign 0.11
R7378:Smarcad1 UTSW 6 65,087,360 (GRCm39) missense probably benign 0.16
R7569:Smarcad1 UTSW 6 65,029,695 (GRCm39) missense probably benign 0.11
R7626:Smarcad1 UTSW 6 65,073,033 (GRCm39) missense possibly damaging 0.71
R7774:Smarcad1 UTSW 6 65,084,814 (GRCm39) missense probably damaging 1.00
R8079:Smarcad1 UTSW 6 65,029,766 (GRCm39) missense possibly damaging 0.51
R8119:Smarcad1 UTSW 6 65,071,303 (GRCm39) missense probably benign
R8129:Smarcad1 UTSW 6 65,044,078 (GRCm39) missense probably benign 0.09
R8558:Smarcad1 UTSW 6 65,060,908 (GRCm39) missense probably benign 0.09
R8679:Smarcad1 UTSW 6 65,088,865 (GRCm39) missense probably benign 0.03
R8770:Smarcad1 UTSW 6 65,029,718 (GRCm39) missense probably benign
R8795:Smarcad1 UTSW 6 65,049,033 (GRCm39) missense probably benign 0.10
R9104:Smarcad1 UTSW 6 65,075,649 (GRCm39) missense probably benign 0.06
R9133:Smarcad1 UTSW 6 65,049,035 (GRCm39) missense probably damaging 0.99
R9400:Smarcad1 UTSW 6 65,050,214 (GRCm39) missense probably damaging 0.97
R9401:Smarcad1 UTSW 6 65,071,321 (GRCm39) missense probably benign 0.00
R9608:Smarcad1 UTSW 6 65,091,318 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTTAAGATGGTAAAAGTTCATTTCC -3'
(R):5'- ACTGTCATAAAAGCTATAACCTGAGTA -3'

Sequencing Primer
(F):5'- CATGATAGAATACGTGGGAT -3'
(R):5'- GACAAGTTATGCTCTGACCTGCAG -3'
Posted On 2015-07-06