Incidental Mutation 'R4391:Olfr312'
ID326371
Institutional Source Beutler Lab
Gene Symbol Olfr312
Ensembl Gene ENSMUSG00000096806
Gene Nameolfactory receptor 312
SynonymsGA_x6K02T2NKPP-575829-574903, MOR222-4P
MMRRC Submission 041682-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R4391 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location58829237-58834780 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58832015 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 287 (V287D)
Ref Sequence ENSEMBL: ENSMUSP00000149697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078217] [ENSMUST00000216407]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078217
AA Change: V287D

PolyPhen 2 Score 0.806 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000077344
Gene: ENSMUSG00000096806
AA Change: V287D

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 5.5e-53 PFAM
Pfam:7TM_GPCR_Srsx 33 303 1.9e-8 PFAM
Pfam:7tm_1 39 288 4.7e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216407
AA Change: V287D

PolyPhen 2 Score 0.806 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.6%
  • 10x: 96.4%
  • 20x: 91.6%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030469F06Rik A T 12: 31,184,623 noncoding transcript Het
A530032D15Rik G A 1: 85,085,131 probably benign Het
Actn2 C T 13: 12,290,748 R394Q probably damaging Het
Atg16l1 A G 1: 87,760,120 D62G probably damaging Het
Atp2b1 A G 10: 99,003,214 T635A probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Dnah1 G A 14: 31,294,835 T1575I probably damaging Het
Dnah7b A G 1: 46,337,594 probably null Het
Dnajc12 A G 10: 63,407,059 T37A probably benign Het
Efcab5 T A 11: 77,090,458 N1354I probably damaging Het
Epas1 T C 17: 86,809,663 L218P probably benign Het
Fbxw15 T A 9: 109,568,232 probably benign Het
Filip1l C A 16: 57,570,792 S581* probably null Het
Focad T A 4: 88,185,958 I358K probably damaging Het
Gm382 T A X: 127,061,319 S376T probably benign Het
Gpsm1 C T 2: 26,323,997 R179C probably damaging Het
Hjurp A G 1: 88,266,561 probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Krt39 C T 11: 99,514,752 A441T probably benign Het
Nrd1 T A 4: 109,046,644 N662K probably damaging Het
Obox5 C T 7: 15,757,974 Q105* probably null Het
Olfr681 T A 7: 105,121,586 M43K possibly damaging Het
Olfr891 A T 9: 38,180,349 V158D probably damaging Het
Pcdhb5 T A 18: 37,322,736 L723Q possibly damaging Het
Pou3f3 G T 1: 42,697,458 A105S unknown Het
Ppp1r3d C T 2: 178,414,087 D41N probably damaging Het
Ppp4r1 A G 17: 65,824,754 N497S probably benign Het
Rad54b T G 4: 11,615,570 N859K probably benign Het
Sh3bp2 C T 5: 34,549,718 S29L probably benign Het
Smarcad1 A T 6: 65,056,459 N142I probably benign Het
Stat3 G A 11: 100,905,552 probably benign Het
Stmn3 T C 2: 181,308,783 R77G probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Xlr3a T C X: 73,091,844 I87V possibly damaging Het
Other mutations in Olfr312
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01897:Olfr312 APN 11 58831639 missense probably damaging 1.00
R0442:Olfr312 UTSW 11 58831431 nonsense probably null
R0540:Olfr312 UTSW 11 58831972 missense probably damaging 0.96
R0607:Olfr312 UTSW 11 58831972 missense probably damaging 0.96
R2366:Olfr312 UTSW 11 58831213 missense probably benign 0.00
R3437:Olfr312 UTSW 11 58831324 missense probably damaging 1.00
R4135:Olfr312 UTSW 11 58831994 missense probably damaging 1.00
R5557:Olfr312 UTSW 11 58831987 missense probably benign 0.01
R5564:Olfr312 UTSW 11 58831213 nonsense probably null
R5854:Olfr312 UTSW 11 58831556 missense probably damaging 0.99
R6791:Olfr312 UTSW 11 58832077 missense probably benign
R7336:Olfr312 UTSW 11 58831924 missense probably damaging 0.99
R7344:Olfr312 UTSW 11 58831482 missense probably damaging 1.00
R7397:Olfr312 UTSW 11 58831289 missense probably benign 0.05
X0067:Olfr312 UTSW 11 58831988 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTGTGGCCACAGTTCTTCG -3'
(R):5'- CTTCTGGCATGCTCTGGTAC -3'

Sequencing Primer
(F):5'- TTCGCATCCCCTCAGTAGAAGG -3'
(R):5'- ACTGGTTTTATGAGCAATGTCAAGG -3'
Posted On2015-07-06