Incidental Mutation 'R4391:Stat3'
ID326375
Institutional Source Beutler Lab
Gene Symbol Stat3
Ensembl Gene ENSMUSG00000004040
Gene Namesignal transducer and activator of transcription 3
Synonyms1110034C02Rik, Aprf
MMRRC Submission 041682-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4391 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location100885098-100939540 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to A at 100905552 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092671] [ENSMUST00000103114] [ENSMUST00000127638] [ENSMUST00000138438]
Predicted Effect probably benign
Transcript: ENSMUST00000092671
SMART Domains Protein: ENSMUSP00000090342
Gene: ENSMUSG00000004040

DomainStartEndE-ValueType
STAT_int 2 122 3.03e-60 SMART
Pfam:STAT_alpha 138 319 2.2e-62 PFAM
Pfam:STAT_bind 321 574 1.8e-130 PFAM
SH2 582 663 2.84e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103114
SMART Domains Protein: ENSMUSP00000099403
Gene: ENSMUSG00000004040

DomainStartEndE-ValueType
STAT_int 2 122 3.03e-60 SMART
Pfam:STAT_alpha 138 319 7.2e-62 PFAM
Pfam:STAT_bind 321 574 5.7e-130 PFAM
SH2 582 663 2.84e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127638
SMART Domains Protein: ENSMUSP00000120152
Gene: ENSMUSG00000004040

DomainStartEndE-ValueType
STAT_int 2 122 3.03e-60 SMART
Pfam:STAT_alpha 141 319 6.8e-59 PFAM
Pfam:STAT_bind 321 573 2.5e-80 PFAM
SH2 582 663 2.84e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130686
Predicted Effect probably benign
Transcript: ENSMUST00000138438
SMART Domains Protein: ENSMUSP00000121677
Gene: ENSMUSG00000004040

DomainStartEndE-ValueType
STAT_int 2 123 5.47e-35 SMART
coiled coil region 171 195 N/A INTRINSIC
coiled coil region 243 265 N/A INTRINSIC
Pfam:STAT_bind 295 548 9.2e-131 PFAM
SH2 556 637 2.84e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152623
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154170
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.6%
  • 10x: 96.4%
  • 20x: 91.6%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein is activated through phosphorylation in response to various cytokines and growth factors including IFNs, EGF, IL5, IL6, HGF, LIF and BMP2. This protein mediates the expression of a variety of genes in response to cell stimuli, and thus plays a key role in many cellular processes such as cell growth and apoptosis. The small GTPase Rac1 has been shown to bind and regulate the activity of this protein. PIAS3 protein is a specific inhibitor of this protein. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations die at embryonic day 6.5-7.5. Conditional, tissue specific mutants are variably viable and show diverse defects including obesity, diabetes, thermal dysregulation and infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030469F06Rik A T 12: 31,184,623 noncoding transcript Het
A530032D15Rik G A 1: 85,085,131 probably benign Het
Actn2 C T 13: 12,290,748 R394Q probably damaging Het
Atg16l1 A G 1: 87,760,120 D62G probably damaging Het
Atp2b1 A G 10: 99,003,214 T635A probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Dnah1 G A 14: 31,294,835 T1575I probably damaging Het
Dnah7b A G 1: 46,337,594 probably null Het
Dnajc12 A G 10: 63,407,059 T37A probably benign Het
Efcab5 T A 11: 77,090,458 N1354I probably damaging Het
Epas1 T C 17: 86,809,663 L218P probably benign Het
Fbxw15 T A 9: 109,568,232 probably benign Het
Filip1l C A 16: 57,570,792 S581* probably null Het
Focad T A 4: 88,185,958 I358K probably damaging Het
Gm382 T A X: 127,061,319 S376T probably benign Het
Gpsm1 C T 2: 26,323,997 R179C probably damaging Het
Hjurp A G 1: 88,266,561 probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Krt39 C T 11: 99,514,752 A441T probably benign Het
Nrd1 T A 4: 109,046,644 N662K probably damaging Het
Obox5 C T 7: 15,757,974 Q105* probably null Het
Olfr312 T A 11: 58,832,015 V287D possibly damaging Het
Olfr681 T A 7: 105,121,586 M43K possibly damaging Het
Olfr891 A T 9: 38,180,349 V158D probably damaging Het
Pcdhb5 T A 18: 37,322,736 L723Q possibly damaging Het
Pou3f3 G T 1: 42,697,458 A105S unknown Het
Ppp1r3d C T 2: 178,414,087 D41N probably damaging Het
Ppp4r1 A G 17: 65,824,754 N497S probably benign Het
Rad54b T G 4: 11,615,570 N859K probably benign Het
Sh3bp2 C T 5: 34,549,718 S29L probably benign Het
Smarcad1 A T 6: 65,056,459 N142I probably benign Het
Stmn3 T C 2: 181,308,783 R77G probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Xlr3a T C X: 73,091,844 I87V possibly damaging Het
Other mutations in Stat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01720:Stat3 APN 11 100903658 missense possibly damaging 0.77
IGL02289:Stat3 APN 11 100905894 missense possibly damaging 0.82
IGL03183:Stat3 APN 11 100902756 missense possibly damaging 0.71
Cunegonde UTSW 11 100898633 missense probably damaging 0.99
Pangloss UTSW 11 100893670 missense possibly damaging 0.92
Stamatios UTSW 11 100893230 missense probably damaging 1.00
Voltaire UTSW 11 100911267 missense probably damaging 0.99
R0143:Stat3 UTSW 11 100895156 missense possibly damaging 0.89
R0395:Stat3 UTSW 11 100889937 splice site probably benign
R0487:Stat3 UTSW 11 100903643 missense probably damaging 1.00
R0589:Stat3 UTSW 11 100908083 missense probably damaging 0.97
R0800:Stat3 UTSW 11 100894155 splice site probably benign
R1393:Stat3 UTSW 11 100888765 splice site probably null
R1927:Stat3 UTSW 11 100894829 missense probably damaging 1.00
R3819:Stat3 UTSW 11 100898633 missense probably damaging 0.99
R4037:Stat3 UTSW 11 100893125 missense probably damaging 1.00
R4598:Stat3 UTSW 11 100903674 missense probably damaging 1.00
R4637:Stat3 UTSW 11 100893230 missense probably damaging 1.00
R5479:Stat3 UTSW 11 100889888 unclassified probably benign
R5909:Stat3 UTSW 11 100903730 missense probably benign 0.00
R5930:Stat3 UTSW 11 100893670 missense possibly damaging 0.92
R5944:Stat3 UTSW 11 100895105 missense probably damaging 1.00
R6002:Stat3 UTSW 11 100903743 missense probably benign 0.01
R6431:Stat3 UTSW 11 100889574 missense possibly damaging 0.79
R6816:Stat3 UTSW 11 100911267 missense probably damaging 0.99
X0033:Stat3 UTSW 11 100893092 missense probably benign
Z1176:Stat3 UTSW 11 100911278 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AAGACTCCTTGAGCAGAGGGAC -3'
(R):5'- CCCAAAGGTAACCTGTGTTTTACTTC -3'

Sequencing Primer
(F):5'- TCTTAACAAGGCTCTACACCATCTG -3'
(R):5'- AACCTGTGTTTTACTTCTGTTTTTG -3'
Posted On2015-07-06