Mutagenetix > Incidental Mutation

Incidental Mutation 'R4391:Filip1l'

326379

Institutional Source

Beutler Lab

Gene Symbol

Filip1l

Ensembl Gene

ENSMUSG00000043336

Gene Name

filamin A interacting protein 1-like

Synonyms

MMRRC Submission

041682-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4391 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

57353093-57573126 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 57570792 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Stop codon at position 581 (S581*)

Ref Sequence

ENSEMBL: ENSMUSP00000124179 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114371] [ENSMUST00000159414] [ENSMUST00000159816] [ENSMUST00000232413]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000114371

SMART Domains

Protein: ENSMUSP00000110011
Gene: ENSMUSG00000022748

Domain	Start	End	E-Value	Type
low complexity region	13	29	N/A	INTRINSIC
Pfam:CMS1	42	266	7.9e-35	PFAM
Pfam:DEAD	127	234	4e-7	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000159414
AA Change: S343*

SMART Domains

Protein: ENSMUSP00000124069
Gene: ENSMUSG00000043336
AA Change: S343*

Domain	Start	End	E-Value	Type
coiled coil region	4	345	N/A	INTRINSIC
coiled coil region	371	542	N/A	INTRINSIC
low complexity region	589	602	N/A	INTRINSIC
low complexity region	868	879	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000159816
AA Change: S581*

SMART Domains

Protein: ENSMUSP00000124179
Gene: ENSMUSG00000043336
AA Change: S581*

Domain	Start	End	E-Value	Type
Pfam:CortBP2	61	246	1.8e-65	PFAM
low complexity region	271	286	N/A	INTRINSIC
low complexity region	483	495	N/A	INTRINSIC
coiled coil region	609	780	N/A	INTRINSIC
low complexity region	827	840	N/A	INTRINSIC
low complexity region	1106	1117	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231282

Predicted Effect

probably benign
Transcript: ENSMUST00000232413

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.6%
3x: 98.6%
10x: 96.4%
20x: 91.6%

Validation Efficiency

100% (40/40)

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6030469F06Rik	A	T	12: 31,184,623		noncoding transcript	Het
A530032D15Rik	G	A	1: 85,085,131		probably benign	Het
Actn2	C	T	13: 12,290,748	R394Q	probably damaging	Het
Atg16l1	A	G	1: 87,760,120	D62G	probably damaging	Het
Atp2b1	A	G	10: 99,003,214	T635A	probably benign	Het
Chil4	G	A	3: 106,203,727	P284S	possibly damaging	Het
Dnah1	G	A	14: 31,294,835	T1575I	probably damaging	Het
Dnah7b	A	G	1: 46,337,594		probably null	Het
Dnajc12	A	G	10: 63,407,059	T37A	probably benign	Het
Efcab5	T	A	11: 77,090,458	N1354I	probably damaging	Het
Epas1	T	C	17: 86,809,663	L218P	probably benign	Het
Fbxw15	T	A	9: 109,568,232		probably benign	Het
Focad	T	A	4: 88,185,958	I358K	probably damaging	Het
Gm382	T	A	X: 127,061,319	S376T	probably benign	Het
Gpsm1	C	T	2: 26,323,997	R179C	probably damaging	Het
Hjurp	A	G	1: 88,266,561		probably benign	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Krt39	C	T	11: 99,514,752	A441T	probably benign	Het
Nrd1	T	A	4: 109,046,644	N662K	probably damaging	Het
Obox5	C	T	7: 15,757,974	Q105*	probably null	Het
Olfr312	T	A	11: 58,832,015	V287D	possibly damaging	Het
Olfr681	T	A	7: 105,121,586	M43K	possibly damaging	Het
Olfr891	A	T	9: 38,180,349	V158D	probably damaging	Het
Pcdhb5	T	A	18: 37,322,736	L723Q	possibly damaging	Het
Pou3f3	G	T	1: 42,697,458	A105S	unknown	Het
Ppp1r3d	C	T	2: 178,414,087	D41N	probably damaging	Het
Ppp4r1	A	G	17: 65,824,754	N497S	probably benign	Het
Rad54b	T	G	4: 11,615,570	N859K	probably benign	Het
Sh3bp2	C	T	5: 34,549,718	S29L	probably benign	Het
Smarcad1	A	T	6: 65,056,459	N142I	probably benign	Het
Stat3	G	A	11: 100,905,552		probably benign	Het
Stmn3	T	C	2: 181,308,783	R77G	probably benign	Het
Ugt1a1	CAGAGAGAGAGAGA	CAGAGAGAGAGA	1: 88,211,984		probably benign	Het
Vmn2r79	A	G	7: 87,001,891	H166R	possibly damaging	Het
Xlr3a	T	C	X: 73,091,844	I87V	possibly damaging	Het

Other mutations in Filip1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01294:Filip1l	APN	16	57572348	nonsense	probably null
IGL01393:Filip1l	APN	16	57572223	missense	probably damaging	1.00
IGL01886:Filip1l	APN	16	57571250	missense	possibly damaging	0.47
IGL02336:Filip1l	APN	16	57571733	splice site	probably null
IGL02503:Filip1l	APN	16	57571575	missense	probably benign	0.00
IGL02608:Filip1l	APN	16	57572106	missense	probably benign	0.05
IGL02681:Filip1l	APN	16	57571779	missense	probably benign	0.10
IGL02687:Filip1l	APN	16	57571127	missense	probably benign	0.30
IGL02982:Filip1l	APN	16	57572232	missense	probably damaging	1.00
IGL03062:Filip1l	APN	16	57506804	missense	probably damaging	1.00
R1027:Filip1l	UTSW	16	57569688	missense	probably benign
R1347:Filip1l	UTSW	16	57570987	missense	probably damaging	1.00
R1347:Filip1l	UTSW	16	57570987	missense	probably damaging	1.00
R1384:Filip1l	UTSW	16	57571289	missense	possibly damaging	0.61
R1655:Filip1l	UTSW	16	57571851	missense	probably damaging	1.00
R1764:Filip1l	UTSW	16	57570038	missense	probably damaging	1.00
R1809:Filip1l	UTSW	16	57506660	missense	probably benign
R1983:Filip1l	UTSW	16	57571274	missense	probably damaging	0.98
R2504:Filip1l	UTSW	16	57570662	missense	possibly damaging	0.76
R2504:Filip1l	UTSW	16	57571047	missense	probably damaging	0.97
R3117:Filip1l	UTSW	16	57506732	missense	probably benign	0.07
R3844:Filip1l	UTSW	16	57572427	missense	probably benign	0.15
R3871:Filip1l	UTSW	16	57513286	missense	probably damaging	0.97
R4231:Filip1l	UTSW	16	57506768	missense	probably benign
R4700:Filip1l	UTSW	16	57570695	missense	probably benign	0.00
R4999:Filip1l	UTSW	16	57570415	missense	probably benign	0.01
R5002:Filip1l	UTSW	16	57571103	missense	probably benign	0.01
R5123:Filip1l	UTSW	16	57570662	missense	possibly damaging	0.76
R5294:Filip1l	UTSW	16	57570036	missense	possibly damaging	0.59
R5429:Filip1l	UTSW	16	57570255	missense	probably damaging	0.99
R5811:Filip1l	UTSW	16	57570294	missense	probably damaging	1.00
R6220:Filip1l	UTSW	16	57569989	missense	probably benign	0.31
R6452:Filip1l	UTSW	16	57506800	missense	possibly damaging	0.82
R6678:Filip1l	UTSW	16	57569970	missense	probably benign	0.00
R6700:Filip1l	UTSW	16	57571248	missense	possibly damaging	0.86
R7260:Filip1l	UTSW	16	57570924	missense	probably damaging	1.00
R7327:Filip1l	UTSW	16	57570937	missense	probably damaging	1.00
R7578:Filip1l	UTSW	16	57513282	missense	probably damaging	0.99
R7691:Filip1l	UTSW	16	57572433	missense	probably benign	0.00
R7950:Filip1l	UTSW	16	57569711	missense	probably damaging	1.00
R8288:Filip1l	UTSW	16	57570554	missense	probably damaging	1.00
R8334:Filip1l	UTSW	16	57570147	missense	probably benign	0.18
R8392:Filip1l	UTSW	16	57571353	missense	probably damaging	1.00
R8742:Filip1l	UTSW	16	57571230	missense	probably damaging	1.00
R9020:Filip1l	UTSW	16	57570695	missense	probably benign	0.00
R9157:Filip1l	UTSW	16	57571617	missense	probably benign	0.04
RF019:Filip1l	UTSW	16	57570641	missense	probably benign	0.07
Z1088:Filip1l	UTSW	16	57513405	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTGATGCTTGTAGATGAACGC -3'
(R):5'- AGGTCATCCTCAATGGCTTTC -3'

Sequencing Primer
(F):5'- TGCTTGTAGATGAACGCAAAAC -3'
(R):5'- AGGTCATCCTCAATGGCTTTCATATC -3'

Posted On

2015-07-06