Incidental Mutation 'R4391:Filip1l'
ID326379
Institutional Source Beutler Lab
Gene Symbol Filip1l
Ensembl Gene ENSMUSG00000043336
Gene Namefilamin A interacting protein 1-like
Synonyms
MMRRC Submission 041682-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4391 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location57353093-57573126 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 57570792 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 581 (S581*)
Ref Sequence ENSEMBL: ENSMUSP00000124179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114371] [ENSMUST00000159414] [ENSMUST00000159816] [ENSMUST00000232413]
Predicted Effect probably benign
Transcript: ENSMUST00000114371
SMART Domains Protein: ENSMUSP00000110011
Gene: ENSMUSG00000022748

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
Pfam:CMS1 42 266 7.9e-35 PFAM
Pfam:DEAD 127 234 4e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000159414
AA Change: S343*
SMART Domains Protein: ENSMUSP00000124069
Gene: ENSMUSG00000043336
AA Change: S343*

DomainStartEndE-ValueType
coiled coil region 4 345 N/A INTRINSIC
coiled coil region 371 542 N/A INTRINSIC
low complexity region 589 602 N/A INTRINSIC
low complexity region 868 879 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159816
AA Change: S581*
SMART Domains Protein: ENSMUSP00000124179
Gene: ENSMUSG00000043336
AA Change: S581*

DomainStartEndE-ValueType
Pfam:CortBP2 61 246 1.8e-65 PFAM
low complexity region 271 286 N/A INTRINSIC
low complexity region 483 495 N/A INTRINSIC
coiled coil region 609 780 N/A INTRINSIC
low complexity region 827 840 N/A INTRINSIC
low complexity region 1106 1117 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231282
Predicted Effect probably benign
Transcript: ENSMUST00000232413
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.6%
  • 10x: 96.4%
  • 20x: 91.6%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030469F06Rik A T 12: 31,184,623 noncoding transcript Het
A530032D15Rik G A 1: 85,085,131 probably benign Het
Actn2 C T 13: 12,290,748 R394Q probably damaging Het
Atg16l1 A G 1: 87,760,120 D62G probably damaging Het
Atp2b1 A G 10: 99,003,214 T635A probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Dnah1 G A 14: 31,294,835 T1575I probably damaging Het
Dnah7b A G 1: 46,337,594 probably null Het
Dnajc12 A G 10: 63,407,059 T37A probably benign Het
Efcab5 T A 11: 77,090,458 N1354I probably damaging Het
Epas1 T C 17: 86,809,663 L218P probably benign Het
Fbxw15 T A 9: 109,568,232 probably benign Het
Focad T A 4: 88,185,958 I358K probably damaging Het
Gm382 T A X: 127,061,319 S376T probably benign Het
Gpsm1 C T 2: 26,323,997 R179C probably damaging Het
Hjurp A G 1: 88,266,561 probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Krt39 C T 11: 99,514,752 A441T probably benign Het
Nrd1 T A 4: 109,046,644 N662K probably damaging Het
Obox5 C T 7: 15,757,974 Q105* probably null Het
Olfr312 T A 11: 58,832,015 V287D possibly damaging Het
Olfr681 T A 7: 105,121,586 M43K possibly damaging Het
Olfr891 A T 9: 38,180,349 V158D probably damaging Het
Pcdhb5 T A 18: 37,322,736 L723Q possibly damaging Het
Pou3f3 G T 1: 42,697,458 A105S unknown Het
Ppp1r3d C T 2: 178,414,087 D41N probably damaging Het
Ppp4r1 A G 17: 65,824,754 N497S probably benign Het
Rad54b T G 4: 11,615,570 N859K probably benign Het
Sh3bp2 C T 5: 34,549,718 S29L probably benign Het
Smarcad1 A T 6: 65,056,459 N142I probably benign Het
Stat3 G A 11: 100,905,552 probably benign Het
Stmn3 T C 2: 181,308,783 R77G probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Xlr3a T C X: 73,091,844 I87V possibly damaging Het
Other mutations in Filip1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Filip1l APN 16 57572348 nonsense probably null
IGL01393:Filip1l APN 16 57572223 missense probably damaging 1.00
IGL01886:Filip1l APN 16 57571250 missense possibly damaging 0.47
IGL02336:Filip1l APN 16 57571733 splice site probably null
IGL02503:Filip1l APN 16 57571575 missense probably benign 0.00
IGL02608:Filip1l APN 16 57572106 missense probably benign 0.05
IGL02681:Filip1l APN 16 57571779 missense probably benign 0.10
IGL02687:Filip1l APN 16 57571127 missense probably benign 0.30
IGL02982:Filip1l APN 16 57572232 missense probably damaging 1.00
IGL03062:Filip1l APN 16 57506804 missense probably damaging 1.00
R1027:Filip1l UTSW 16 57569688 missense probably benign
R1347:Filip1l UTSW 16 57570987 missense probably damaging 1.00
R1347:Filip1l UTSW 16 57570987 missense probably damaging 1.00
R1384:Filip1l UTSW 16 57571289 missense possibly damaging 0.61
R1655:Filip1l UTSW 16 57571851 missense probably damaging 1.00
R1764:Filip1l UTSW 16 57570038 missense probably damaging 1.00
R1809:Filip1l UTSW 16 57506660 missense probably benign
R1983:Filip1l UTSW 16 57571274 missense probably damaging 0.98
R2504:Filip1l UTSW 16 57570662 missense possibly damaging 0.76
R2504:Filip1l UTSW 16 57571047 missense probably damaging 0.97
R3117:Filip1l UTSW 16 57506732 missense probably benign 0.07
R3844:Filip1l UTSW 16 57572427 missense probably benign 0.15
R3871:Filip1l UTSW 16 57513286 missense probably damaging 0.97
R4231:Filip1l UTSW 16 57506768 missense probably benign
R4700:Filip1l UTSW 16 57570695 missense probably benign 0.00
R4999:Filip1l UTSW 16 57570415 missense probably benign 0.01
R5002:Filip1l UTSW 16 57571103 missense probably benign 0.01
R5123:Filip1l UTSW 16 57570662 missense possibly damaging 0.76
R5294:Filip1l UTSW 16 57570036 missense possibly damaging 0.59
R5429:Filip1l UTSW 16 57570255 missense probably damaging 0.99
R5811:Filip1l UTSW 16 57570294 missense probably damaging 1.00
R6220:Filip1l UTSW 16 57569989 missense probably benign 0.31
R6452:Filip1l UTSW 16 57506800 missense possibly damaging 0.82
R6678:Filip1l UTSW 16 57569970 missense probably benign 0.00
R6700:Filip1l UTSW 16 57571248 missense possibly damaging 0.86
R7260:Filip1l UTSW 16 57570924 missense probably damaging 1.00
R7327:Filip1l UTSW 16 57570937 missense probably damaging 1.00
R7578:Filip1l UTSW 16 57513282 missense probably damaging 0.99
R7691:Filip1l UTSW 16 57572433 missense probably benign 0.00
R7950:Filip1l UTSW 16 57569711 missense probably damaging 1.00
R8288:Filip1l UTSW 16 57570554 missense probably damaging 1.00
R8334:Filip1l UTSW 16 57570147 missense probably benign 0.18
R8392:Filip1l UTSW 16 57571353 missense probably damaging 1.00
RF019:Filip1l UTSW 16 57570641 missense probably benign 0.07
Z1088:Filip1l UTSW 16 57513405 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGATGCTTGTAGATGAACGC -3'
(R):5'- AGGTCATCCTCAATGGCTTTC -3'

Sequencing Primer
(F):5'- TGCTTGTAGATGAACGCAAAAC -3'
(R):5'- AGGTCATCCTCAATGGCTTTCATATC -3'
Posted On2015-07-06