Incidental Mutation 'R4391:Epas1'
ID326382
Institutional Source Beutler Lab
Gene Symbol Epas1
Ensembl Gene ENSMUSG00000024140
Gene Nameendothelial PAS domain protein 1
SynonymsHIF-2alpha, HRF, HLF, bHLHe73, hypoxia inducible transcription factor 2alpha, HIF2A, MOP2, Hif like protein
MMRRC Submission 041682-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4391 (G1)
Quality Score136
Status Validated
Chromosome17
Chromosomal Location86753907-86833410 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86809663 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 218 (L218P)
Ref Sequence ENSEMBL: ENSMUSP00000024954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024954]
Predicted Effect probably benign
Transcript: ENSMUST00000024954
AA Change: L218P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000024954
Gene: ENSMUSG00000024140
AA Change: L218P

DomainStartEndE-ValueType
HLH 20 75 3.98e-9 SMART
PAS 86 152 6.39e-9 SMART
PAS 232 298 6.75e-8 SMART
PAC 304 347 5.56e-9 SMART
low complexity region 464 484 N/A INTRINSIC
Pfam:HIF-1 516 548 4.9e-21 PFAM
low complexity region 725 737 N/A INTRINSIC
low complexity region 775 796 N/A INTRINSIC
Pfam:HIF-1a_CTAD 837 873 3.6e-23 PFAM
Meta Mutation Damage Score 0.0601 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.6%
  • 10x: 96.4%
  • 20x: 91.6%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor involved in the induction of genes regulated by oxygen, which is induced as oxygen levels fall. The encoded protein contains a basic-helix-loop-helix domain protein dimerization domain as well as a domain found in proteins in signal transduction pathways which respond to oxygen levels. Mutations in this gene are associated with erythrocytosis familial type 4. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for null mutations display prenatal, neonatal or postnatal lethality. For some alleles lethality is associated with vascular abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030469F06Rik A T 12: 31,184,623 noncoding transcript Het
A530032D15Rik G A 1: 85,085,131 probably benign Het
Actn2 C T 13: 12,290,748 R394Q probably damaging Het
Atg16l1 A G 1: 87,760,120 D62G probably damaging Het
Atp2b1 A G 10: 99,003,214 T635A probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Dnah1 G A 14: 31,294,835 T1575I probably damaging Het
Dnah7b A G 1: 46,337,594 probably null Het
Dnajc12 A G 10: 63,407,059 T37A probably benign Het
Efcab5 T A 11: 77,090,458 N1354I probably damaging Het
Fbxw15 T A 9: 109,568,232 probably benign Het
Filip1l C A 16: 57,570,792 S581* probably null Het
Focad T A 4: 88,185,958 I358K probably damaging Het
Gm382 T A X: 127,061,319 S376T probably benign Het
Gpsm1 C T 2: 26,323,997 R179C probably damaging Het
Hjurp A G 1: 88,266,561 probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Krt39 C T 11: 99,514,752 A441T probably benign Het
Nrd1 T A 4: 109,046,644 N662K probably damaging Het
Obox5 C T 7: 15,757,974 Q105* probably null Het
Olfr312 T A 11: 58,832,015 V287D possibly damaging Het
Olfr681 T A 7: 105,121,586 M43K possibly damaging Het
Olfr891 A T 9: 38,180,349 V158D probably damaging Het
Pcdhb5 T A 18: 37,322,736 L723Q possibly damaging Het
Pou3f3 G T 1: 42,697,458 A105S unknown Het
Ppp1r3d C T 2: 178,414,087 D41N probably damaging Het
Ppp4r1 A G 17: 65,824,754 N497S probably benign Het
Rad54b T G 4: 11,615,570 N859K probably benign Het
Sh3bp2 C T 5: 34,549,718 S29L probably benign Het
Smarcad1 A T 6: 65,056,459 N142I probably benign Het
Stat3 G A 11: 100,905,552 probably benign Het
Stmn3 T C 2: 181,308,783 R77G probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Xlr3a T C X: 73,091,844 I87V possibly damaging Het
Other mutations in Epas1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01934:Epas1 APN 17 86823729 missense probably damaging 1.00
IGL02150:Epas1 APN 17 86805289 missense probably damaging 1.00
IGL02221:Epas1 APN 17 86827847 missense possibly damaging 0.50
IGL02555:Epas1 APN 17 86829064 missense probably benign
IGL02739:Epas1 APN 17 86805282 missense probably damaging 0.98
IGL03389:Epas1 APN 17 86823703 missense probably benign 0.10
R0043:Epas1 UTSW 17 86823812 missense probably damaging 0.99
R0363:Epas1 UTSW 17 86805848 splice site probably benign
R0399:Epas1 UTSW 17 86805193 missense probably benign 0.01
R0737:Epas1 UTSW 17 86829456 missense possibly damaging 0.45
R1542:Epas1 UTSW 17 86824490 missense possibly damaging 0.67
R1662:Epas1 UTSW 17 86829027 missense probably damaging 0.99
R1885:Epas1 UTSW 17 86805295 missense probably damaging 1.00
R2197:Epas1 UTSW 17 86829043 missense probably benign 0.01
R3056:Epas1 UTSW 17 86830981 missense probably damaging 0.99
R4342:Epas1 UTSW 17 86823800 missense probably damaging 1.00
R4774:Epas1 UTSW 17 86805758 missense probably damaging 1.00
R4798:Epas1 UTSW 17 86805839 missense probably benign
R4989:Epas1 UTSW 17 86809454 missense probably damaging 1.00
R5133:Epas1 UTSW 17 86809454 missense probably damaging 1.00
R5604:Epas1 UTSW 17 86805772 missense probably damaging 1.00
R5811:Epas1 UTSW 17 86823775 missense probably damaging 1.00
R5838:Epas1 UTSW 17 86823686 missense possibly damaging 0.94
R5885:Epas1 UTSW 17 86827544 missense probably damaging 1.00
R5932:Epas1 UTSW 17 86827646 missense possibly damaging 0.66
R6045:Epas1 UTSW 17 86809399 missense probably damaging 0.99
R6145:Epas1 UTSW 17 86829429 missense probably benign 0.01
R7517:Epas1 UTSW 17 86831098 missense possibly damaging 0.92
R7552:Epas1 UTSW 17 86829043 missense probably benign 0.01
R7828:Epas1 UTSW 17 86827699 missense probably benign 0.04
R8081:Epas1 UTSW 17 86829369 missense probably benign
R8111:Epas1 UTSW 17 86818432 nonsense probably null
R8558:Epas1 UTSW 17 86809468 missense possibly damaging 0.89
R8948:Epas1 UTSW 17 86827492 missense probably benign 0.01
Z1176:Epas1 UTSW 17 86827946 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- CGGACTGTCAACCTCAAGTC -3'
(R):5'- TGTCACACTCTCACAGATGC -3'

Sequencing Primer
(F):5'- TCAAGTCGGCCACCTGGAAG -3'
(R):5'- TCTCACAGATGCACACTGGTAAG -3'
Posted On2015-07-06