Incidental Mutation 'R4392:Ugt1a1'
ID 326387
Institutional Source Beutler Lab
Gene Symbol Ugt1a1
Ensembl Gene ENSMUSG00000089960
Gene Name UDP glucuronosyltransferase 1 family, polypeptide A1
Synonyms Udpgt-1a, UgtBr1, UGT1A01, Gnt1
MMRRC Submission 041127-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.821) question?
Stock # R4392 (G1)
Quality Score 217
Status Validated
Chromosome 1
Chromosomal Location 88139681-88146719 bp(+) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) CAGAGAGAGAGAGA to CAGAGAGAGAGA at 88139706 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014263] [ENSMUST00000049289] [ENSMUST00000058237] [ENSMUST00000073049] [ENSMUST00000073772] [ENSMUST00000097659] [ENSMUST00000113134] [ENSMUST00000113135] [ENSMUST00000150634] [ENSMUST00000113139] [ENSMUST00000173325] [ENSMUST00000140092] [ENSMUST00000126203] [ENSMUST00000113142] [ENSMUST00000138182] [ENSMUST00000113137] [ENSMUST00000113138]
AlphaFold Q63886
Predicted Effect probably benign
Transcript: ENSMUST00000014263
SMART Domains Protein: ENSMUSP00000014263
Gene: ENSMUSG00000054545

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.2e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049289
SMART Domains Protein: ENSMUSP00000037258
Gene: ENSMUSG00000090171

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:UDPGT 28 524 2.2e-247 PFAM
Pfam:Glyco_tran_28_C 363 452 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058237
SMART Domains Protein: ENSMUSP00000058683
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 522 1.5e-234 PFAM
Pfam:Glyco_tran_28_C 361 450 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073049
SMART Domains Protein: ENSMUSP00000072803
Gene: ENSMUSG00000089960

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:UDPGT 30 526 5.8e-241 PFAM
Pfam:Glyco_tran_28_C 365 454 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073772
SMART Domains Protein: ENSMUSP00000073444
Gene: ENSMUSG00000090175

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 519 2.3e-232 PFAM
Pfam:Glyco_tran_28_C 358 447 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097659
SMART Domains Protein: ENSMUSP00000095263
Gene: ENSMUSG00000089943

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:UDPGT 25 520 6.7e-246 PFAM
Pfam:Glyco_tran_28_C 359 448 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113134
SMART Domains Protein: ENSMUSP00000108759
Gene: ENSMUSG00000054545

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 2.7e-232 PFAM
Pfam:Glyco_tran_28_C 361 450 4.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174821
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124852
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173165
Predicted Effect probably benign
Transcript: ENSMUST00000113135
SMART Domains Protein: ENSMUSP00000108760
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.2e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150634
SMART Domains Protein: ENSMUSP00000123452
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 9.5e-11 PFAM
Pfam:UDPGT 58 207 2e-90 PFAM
Pfam:Glyco_tran_28_C 137 207 4.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113139
SMART Domains Protein: ENSMUSP00000108764
Gene: ENSMUSG00000089675

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 521 3.6e-237 PFAM
Pfam:Glyco_tran_28_C 360 449 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173325
SMART Domains Protein: ENSMUSP00000134443
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 61 3.4e-10 PFAM
Pfam:UDPGT 59 210 8.9e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140092
SMART Domains Protein: ENSMUSP00000115642
Gene: ENSMUSG00000054545

DomainStartEndE-ValueType
Pfam:UDPGT 1 166 9.3e-98 PFAM
Pfam:Glyco_tran_28_C 96 166 4.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126203
SMART Domains Protein: ENSMUSP00000116653
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 4.6e-11 PFAM
Pfam:UDPGT 59 127 8.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113142
SMART Domains Protein: ENSMUSP00000108767
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 521 7.3e-231 PFAM
Pfam:Glyco_tran_28_C 360 449 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138182
SMART Domains Protein: ENSMUSP00000119985
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 7e-11 PFAM
Pfam:UDPGT 58 207 1.9e-90 PFAM
Pfam:Glyco_tran_28_C 137 207 4.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113137
SMART Domains Protein: ENSMUSP00000108762
Gene: ENSMUSG00000090145

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.3e-231 PFAM
Pfam:Glyco_tran_28_C 361 450 2.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113138
SMART Domains Protein: ENSMUSP00000108763
Gene: ENSMUSG00000090145

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 7.3e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 6.6e-9 PFAM
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.5%
  • 10x: 96.1%
  • 20x: 90.5%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. The preferred substrate of this enzyme is bilirubin, although it also has moderate activity with simple phenols, flavones, and C18 steroids. Mutations in this gene result in Crigler-Najjar syndromes types I and II and in Gilbert syndrome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik C T 14: 54,822,435 (GRCm39) probably null Het
Abca13 A C 11: 9,259,034 (GRCm39) K2920T possibly damaging Het
Amy2b T G 3: 113,056,724 (GRCm39) noncoding transcript Het
Anapc1 T C 2: 128,518,169 (GRCm39) probably null Het
Bmp7 T G 2: 172,758,335 (GRCm39) D178A probably benign Het
Brsk1 T A 7: 4,701,749 (GRCm39) I170N probably damaging Het
Bub3 C T 7: 131,168,064 (GRCm39) A187V probably benign Het
Cacna2d2 A G 9: 107,277,479 (GRCm39) H71R possibly damaging Het
Cdrt4 A T 11: 62,842,179 (GRCm39) K20N probably benign Het
Clec12a A T 6: 129,330,427 (GRCm39) probably benign Het
Col12a1 T A 9: 79,569,770 (GRCm39) Y1600F probably damaging Het
Cyp2a12 T A 7: 26,728,700 (GRCm39) I57N probably damaging Het
Dip2b T C 15: 100,059,917 (GRCm39) L223P probably damaging Het
Dnah5 G A 15: 28,289,375 (GRCm39) R1188H probably benign Het
Dop1a T C 9: 86,385,196 (GRCm39) probably benign Het
Efcab5 T A 11: 76,981,284 (GRCm39) N1354I probably damaging Het
Eif4b T A 15: 101,995,076 (GRCm39) probably null Het
Erlec1 A G 11: 30,893,697 (GRCm39) probably null Het
Esp24 T C 17: 39,350,968 (GRCm39) probably benign Het
Esp34 T C 17: 38,870,382 (GRCm39) V24A possibly damaging Het
Fbxw15 T A 9: 109,397,300 (GRCm39) probably benign Het
Foxc2 T C 8: 121,844,191 (GRCm39) S280P probably damaging Het
Gm21738 G C 14: 19,417,178 (GRCm38) L117V probably benign Het
Grk3 A G 5: 113,068,002 (GRCm39) F467S probably damaging Het
Grwd1 C T 7: 45,477,204 (GRCm39) G228S probably damaging Het
Gtf2i T C 5: 134,289,483 (GRCm39) E399G probably damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Homer3 G A 8: 70,742,793 (GRCm39) probably null Het
Ift56 A G 6: 38,358,492 (GRCm39) probably benign Het
Lhx4 A G 1: 155,585,880 (GRCm39) Y83H probably damaging Het
Mdga1 T C 17: 30,069,630 (GRCm39) T413A probably damaging Het
Mideas A T 12: 84,219,885 (GRCm39) D356E probably benign Het
Mmrn2 T A 14: 34,119,573 (GRCm39) L184H probably damaging Het
Mroh2a C T 1: 88,187,311 (GRCm39) R133C probably damaging Het
Myh13 A C 11: 67,235,707 (GRCm39) probably null Het
Nkain3 C A 4: 20,282,985 (GRCm39) R116L possibly damaging Het
Nxph2 A C 2: 23,290,284 (GRCm39) Q212P probably damaging Het
Or4f7d-ps1 T C 2: 111,674,690 (GRCm39) noncoding transcript Het
Or4k15c A G 14: 50,322,060 (GRCm39) F26S probably benign Het
Otog T C 7: 45,934,548 (GRCm39) Y1369H probably damaging Het
Prl A G 13: 27,248,334 (GRCm39) I131V possibly damaging Het
Ptprg A T 14: 12,142,467 (GRCm38) I373F possibly damaging Het
Rad18 A T 6: 112,670,490 (GRCm39) C25S probably damaging Het
Rgs12 A G 5: 35,189,655 (GRCm39) T678A probably damaging Het
Scaper T A 9: 55,765,399 (GRCm39) E557V probably damaging Het
Scube3 C T 17: 28,383,762 (GRCm39) P511L probably null Het
Sgpl1 A G 10: 60,940,231 (GRCm39) probably benign Het
Slc10a1 C A 12: 81,014,578 (GRCm39) E47D probably damaging Het
Sptbn4 T C 7: 27,117,896 (GRCm39) N369S probably damaging Het
Sstr5 T C 17: 25,710,198 (GRCm39) T344A probably benign Het
Tgm4 C T 9: 122,895,817 (GRCm39) T631I probably benign Het
Tmprss15 A G 16: 78,821,326 (GRCm39) Y457H probably damaging Het
Trpm7 A T 2: 126,637,429 (GRCm39) probably null Het
Trpm7 A T 2: 126,690,458 (GRCm39) W207R probably damaging Het
Ugt1a10 C T 1: 88,142,845 (GRCm39) P113L probably damaging Het
Usp2 A T 9: 44,002,556 (GRCm39) H384L probably damaging Het
Vmn2r27 C T 6: 124,207,135 (GRCm39) V169I probably benign Het
Vopp1 A C 6: 57,739,461 (GRCm39) F29C probably damaging Het
Wrn T C 8: 33,741,860 (GRCm39) D953G probably damaging Het
Zfp759 T A 13: 67,287,707 (GRCm39) C419* probably null Het
Other mutations in Ugt1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02984:Ugt1a1 UTSW 1 88,140,093 (GRCm39) frame shift probably null
IGL03055:Ugt1a1 UTSW 1 88,140,093 (GRCm39) frame shift probably null
IGL03134:Ugt1a1 UTSW 1 88,140,093 (GRCm39) frame shift probably null
IGL03138:Ugt1a1 UTSW 1 88,140,093 (GRCm39) frame shift probably null
IGL03147:Ugt1a1 UTSW 1 88,140,093 (GRCm39) frame shift probably null
R0196:Ugt1a1 UTSW 1 88,140,277 (GRCm39) missense possibly damaging 0.67
R0398:Ugt1a1 UTSW 1 88,140,093 (GRCm39) frame shift probably null
R0442:Ugt1a1 UTSW 1 88,140,093 (GRCm39) frame shift probably null
R2871:Ugt1a1 UTSW 1 88,140,093 (GRCm39) frame shift probably null
R2872:Ugt1a1 UTSW 1 88,140,093 (GRCm39) frame shift probably null
R4391:Ugt1a1 UTSW 1 88,139,706 (GRCm39) intron probably benign
R4393:Ugt1a1 UTSW 1 88,139,706 (GRCm39) intron probably benign
R4394:Ugt1a1 UTSW 1 88,139,706 (GRCm39) intron probably benign
R4397:Ugt1a1 UTSW 1 88,139,706 (GRCm39) intron probably benign
R4402:Ugt1a1 UTSW 1 88,139,706 (GRCm39) intron probably benign
R4664:Ugt1a1 UTSW 1 88,139,706 (GRCm39) intron probably benign
R4665:Ugt1a1 UTSW 1 88,139,706 (GRCm39) intron probably benign
R4947:Ugt1a1 UTSW 1 88,139,706 (GRCm39) intron probably benign
R4961:Ugt1a1 UTSW 1 88,139,706 (GRCm39) intron probably benign
R4986:Ugt1a1 UTSW 1 88,139,706 (GRCm39) intron probably benign
R5052:Ugt1a1 UTSW 1 88,139,706 (GRCm39) intron probably benign
R6464:Ugt1a1 UTSW 1 88,139,706 (GRCm39) intron probably benign
R6618:Ugt1a1 UTSW 1 88,139,706 (GRCm39) intron probably benign
R8215:Ugt1a1 UTSW 1 88,139,706 (GRCm39) intron probably benign
R8243:Ugt1a1 UTSW 1 88,139,706 (GRCm39) intron probably benign
Z1188:Ugt1a1 UTSW 1 88,139,706 (GRCm39) intron probably benign
Z1190:Ugt1a1 UTSW 1 88,139,706 (GRCm39) intron probably benign
Predicted Primers PCR Primer
(F):5'- GAGTAGCTGTCAGTTCAATTGC -3'
(R):5'- TATGACCACAACTTCGTGCC -3'

Sequencing Primer
(F):5'- TGCTGTTATTTGTTAAGGAACTCAG -3'
(R):5'- CTTCTGCTGGAGCTGCTGAATAAC -3'
Posted On 2015-07-06