Incidental Mutation 'R0013:Dchs1'
ID32639
Institutional Source Beutler Lab
Gene Symbol Dchs1
Ensembl Gene ENSMUSG00000036862
Gene Namedachsous cadherin related 1
Synonyms3110041P15Rik, C130033F22Rik
MMRRC Submission 038308-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0013 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location105752990-105787654 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105755836 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 2500 (T2500S)
Ref Sequence ENSEMBL: ENSMUSP00000077574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033184] [ENSMUST00000078482] [ENSMUST00000210066]
Predicted Effect probably benign
Transcript: ENSMUST00000033184
SMART Domains Protein: ENSMUSP00000033184
Gene: ENSMUSG00000030894

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pro-kuma_activ 32 176 4.53e-50 SMART
low complexity region 177 189 N/A INTRINSIC
Pfam:Peptidase_S8 251 492 1.1e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000078482
AA Change: T2500S

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077574
Gene: ENSMUSG00000036862
AA Change: T2500S

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
CA 58 135 5.2e-11 SMART
CA 159 247 6.1e-17 SMART
CA 271 354 2.6e-30 SMART
CA 382 464 7.8e-26 SMART
CA 489 570 1.2e-34 SMART
CA 594 677 1.9e-27 SMART
CA 701 782 5.3e-11 SMART
CA 806 886 1e-12 SMART
CA 910 990 3.3e-14 SMART
CA 1016 1097 3.6e-18 SMART
CA 1121 1203 3.1e-34 SMART
CA 1233 1307 8.8e-16 SMART
low complexity region 1323 1335 N/A INTRINSIC
CA 1344 1427 9.9e-9 SMART
CA 1451 1537 1.5e-23 SMART
CA 1560 1640 7.2e-32 SMART
CA 1664 1742 1.8e-31 SMART
CA 1765 1846 7.8e-30 SMART
CA 1870 1951 3.7e-26 SMART
low complexity region 1957 1965 N/A INTRINSIC
CA 1979 2059 1.1e-6 SMART
CA 2083 2162 2.7e-18 SMART
CA 2186 2268 2.2e-26 SMART
CA 2291 2367 1e-18 SMART
CA 2391 2473 1.8e-23 SMART
CA 2497 2593 3.5e-21 SMART
CA 2617 2697 1.2e-25 SMART
CA 2721 2804 1.9e-18 SMART
CA 2828 2919 3e-3 SMART
transmembrane domain 2932 2954 N/A INTRINSIC
low complexity region 3001 3017 N/A INTRINSIC
low complexity region 3046 3055 N/A INTRINSIC
low complexity region 3088 3097 N/A INTRINSIC
low complexity region 3185 3196 N/A INTRINSIC
low complexity region 3237 3259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140959
Predicted Effect probably benign
Transcript: ENSMUST00000210066
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210840
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211204
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211659
Meta Mutation Damage Score 0.0965 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 94% (79/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily whose members encode calcium-dependent cell-cell adhesion molecules. The encoded protein has a signal peptide, 27 cadherin repeat domains and a unique cytoplasmic region. This particular cadherin family member is expressed in fibroblasts but not in melanocytes or keratinocytes. The cell-cell adhesion of fibroblasts is thought to be necessary for wound healing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, growth retardation, small lungs, abnormal cochlea morphology, abnormal kidney morphology, cardiovascular abnormalities and skeletal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A G 10: 76,457,512 M156V probably benign Het
Adnp2 A T 18: 80,129,745 V483D probably damaging Het
Aff1 G T 5: 103,828,484 E491* probably null Het
Agl A T 3: 116,776,608 C911* probably null Het
Akt2 A G 7: 27,636,058 D284G probably damaging Het
Alox15 A G 11: 70,349,635 M240T possibly damaging Het
Antxr2 A G 5: 97,979,985 V229A probably damaging Het
Arap2 G A 5: 62,683,484 L680F probably damaging Het
Btaf1 A G 19: 36,958,373 T188A probably benign Het
Btnl6 G A 17: 34,515,531 Q86* probably null Het
C2cd3 T A 7: 100,416,062 L685H probably damaging Het
Cdh23 T C 10: 60,413,173 T878A possibly damaging Het
Clec4b2 T C 6: 123,202,149 Y137H probably damaging Het
Def6 A G 17: 28,217,092 Y75C probably damaging Het
Dhx33 A T 11: 70,993,635 F448L probably damaging Het
Dner C T 1: 84,494,893 probably benign Het
Dnmbp G A 19: 43,902,231 P366S probably benign Het
Eif4g3 T C 4: 138,175,848 C1160R possibly damaging Het
Elmod1 G A 9: 53,912,901 probably benign Het
Faah C A 4: 116,004,391 L305F probably damaging Het
Fam71b A G 11: 46,406,804 T312A unknown Het
Flt1 A G 5: 147,571,014 probably benign Het
Fyco1 A T 9: 123,822,406 N1196K probably benign Het
Galnt18 T C 7: 111,554,457 N320S probably damaging Het
Glp2r C A 11: 67,709,712 G437V possibly damaging Het
Gm4884 T C 7: 41,044,292 S562P probably damaging Het
Gm9936 A G 5: 114,857,347 probably benign Het
Gpn2 C A 4: 133,584,792 P112T probably damaging Het
Grm4 A G 17: 27,431,575 Y816H probably benign Het
Helz2 A T 2: 181,240,959 S14T probably benign Het
Htt T C 5: 34,820,104 L778P probably benign Het
Il11ra1 T C 4: 41,765,060 S129P probably damaging Het
Ints11 T C 4: 155,887,168 F315S probably damaging Het
Itga11 A T 9: 62,776,613 N1059Y possibly damaging Het
Jak3 A G 8: 71,684,327 S716G probably damaging Het
Kcns1 G T 2: 164,168,643 D65E probably benign Het
Kdm5d A T Y: 941,715 K1305N probably benign Het
Kif26a G T 12: 112,177,880 V1523L probably benign Het
Mboat7 A G 7: 3,683,822 S340P probably damaging Het
Mctp2 T C 7: 72,229,408 I234V probably benign Het
Mex3c G A 18: 73,590,551 A572T probably benign Het
Mpp3 C A 11: 102,005,425 R424L probably benign Het
Mroh4 T A 15: 74,608,237 probably benign Het
Myo9a A T 9: 59,860,206 probably benign Het
Myog T A 1: 134,290,235 H60Q probably damaging Het
Nlrp9a T A 7: 26,571,225 probably null Het
Notch1 A G 2: 26,473,818 V868A possibly damaging Het
Olfr352 A G 2: 36,870,160 N198S probably damaging Het
Olfr59 T A 11: 74,289,051 I135N possibly damaging Het
Olfr73 T C 2: 88,034,266 Y291C possibly damaging Het
Olfr980 A T 9: 40,006,355 I198N probably damaging Het
Pink1 T C 4: 138,317,401 T342A probably benign Het
Plb1 T A 5: 32,349,615 probably benign Het
Plec T C 15: 76,178,246 D2524G probably damaging Het
Plekhg4 G T 8: 105,375,396 E6* probably null Het
Polq T C 16: 37,061,839 F1455S possibly damaging Het
Ppm1e A G 11: 87,249,058 probably benign Het
Prkaca G A 8: 83,988,303 M119I possibly damaging Het
Prss46 G T 9: 110,850,055 S108I probably damaging Het
Ptma C T 1: 86,529,776 probably benign Het
Rab11fip4 C T 11: 79,689,653 T437M probably benign Het
Rngtt T A 4: 33,379,409 M437K probably benign Het
Rrn3 T A 16: 13,813,113 D604E possibly damaging Het
Scn4a A G 11: 106,348,405 probably benign Het
Sis A G 3: 72,910,476 L1468P possibly damaging Het
Slit3 A G 11: 35,707,918 M1450V probably benign Het
Smg5 T C 3: 88,349,233 S269P probably benign Het
Sntg1 T C 1: 8,463,462 T323A probably damaging Het
Son C T 16: 91,651,662 T37I probably damaging Het
Stk17b T C 1: 53,764,132 I41M probably benign Het
Tgm5 T A 2: 121,076,882 Y120F probably damaging Het
Tppp A G 13: 74,021,360 K73R possibly damaging Het
Ttn C A 2: 76,739,158 K27130N probably damaging Het
Ttn C T 2: 76,907,752 V4148I probably benign Het
Uba7 A T 9: 107,978,249 Y375F probably damaging Het
Ugcg T C 4: 59,213,931 L171P possibly damaging Het
Vsig2 T C 9: 37,542,576 probably benign Het
Zcchc11 T A 4: 108,530,955 probably benign Het
Zfp839 T A 12: 110,868,386 S692T possibly damaging Het
Other mutations in Dchs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Dchs1 APN 7 105758743 missense probably damaging 1.00
IGL00422:Dchs1 APN 7 105758029 missense possibly damaging 0.88
IGL00427:Dchs1 APN 7 105758424 missense probably damaging 0.98
IGL00469:Dchs1 APN 7 105755261 missense probably damaging 1.00
IGL00470:Dchs1 APN 7 105758207 missense probably damaging 1.00
IGL00534:Dchs1 APN 7 105757943 missense probably benign
IGL01292:Dchs1 APN 7 105760891 missense probably damaging 0.98
IGL01380:Dchs1 APN 7 105762211 missense probably damaging 1.00
IGL01396:Dchs1 APN 7 105772283 missense probably damaging 1.00
IGL01448:Dchs1 APN 7 105771927 missense probably damaging 0.98
IGL01759:Dchs1 APN 7 105755302 missense probably benign 0.00
IGL01829:Dchs1 APN 7 105755397 missense probably damaging 0.99
IGL01946:Dchs1 APN 7 105759105 missense probably damaging 1.00
IGL01955:Dchs1 APN 7 105757591 missense probably benign 0.00
IGL02012:Dchs1 APN 7 105764297 missense probably damaging 0.98
IGL02222:Dchs1 APN 7 105764887 missense probably damaging 1.00
IGL02261:Dchs1 APN 7 105772569 missense probably damaging 1.00
IGL02365:Dchs1 APN 7 105755188 missense probably benign 0.22
IGL02430:Dchs1 APN 7 105771971 missense probably benign 0.34
IGL02500:Dchs1 APN 7 105755806 missense probably benign
IGL02741:Dchs1 APN 7 105757323 missense probably damaging 1.00
IGL02890:Dchs1 APN 7 105756491 missense probably damaging 1.00
IGL03213:Dchs1 APN 7 105755072 missense probably damaging 1.00
P0026:Dchs1 UTSW 7 105758405 missense probably damaging 0.99
PIT4377001:Dchs1 UTSW 7 105757588 missense probably damaging 1.00
PIT4791001:Dchs1 UTSW 7 105758971 missense probably damaging 1.00
R0090:Dchs1 UTSW 7 105755932 missense probably benign 0.18
R0091:Dchs1 UTSW 7 105766094 splice site probably benign
R0193:Dchs1 UTSW 7 105764983 missense probably benign 0.40
R0395:Dchs1 UTSW 7 105758538 missense probably damaging 1.00
R0448:Dchs1 UTSW 7 105765927 missense probably benign 0.00
R0480:Dchs1 UTSW 7 105771489 missense probably benign 0.14
R0485:Dchs1 UTSW 7 105772727 missense probably benign 0.00
R0566:Dchs1 UTSW 7 105759195 missense probably benign 0.00
R0571:Dchs1 UTSW 7 105771996 missense probably damaging 1.00
R0573:Dchs1 UTSW 7 105758778 missense probably damaging 0.98
R0577:Dchs1 UTSW 7 105764255 missense possibly damaging 0.78
R0622:Dchs1 UTSW 7 105763449 missense probably damaging 1.00
R0654:Dchs1 UTSW 7 105772349 missense probably damaging 1.00
R0677:Dchs1 UTSW 7 105764984 missense probably damaging 1.00
R1171:Dchs1 UTSW 7 105757714 missense probably benign
R1241:Dchs1 UTSW 7 105758178 missense probably damaging 1.00
R1389:Dchs1 UTSW 7 105755571 missense probably benign 0.40
R1427:Dchs1 UTSW 7 105766191 missense probably benign 0.06
R1458:Dchs1 UTSW 7 105755244 missense probably damaging 1.00
R1513:Dchs1 UTSW 7 105772071 nonsense probably null
R1524:Dchs1 UTSW 7 105764525 missense probably damaging 1.00
R1525:Dchs1 UTSW 7 105758931 missense probably damaging 1.00
R1534:Dchs1 UTSW 7 105772040 missense probably damaging 0.98
R1567:Dchs1 UTSW 7 105771861 missense probably benign 0.01
R1577:Dchs1 UTSW 7 105765955 missense probably damaging 1.00
R1603:Dchs1 UTSW 7 105762770 missense probably benign 0.24
R1676:Dchs1 UTSW 7 105754921 missense probably benign 0.40
R1794:Dchs1 UTSW 7 105771720 missense probably benign 0.02
R1826:Dchs1 UTSW 7 105757627 missense probably damaging 1.00
R1892:Dchs1 UTSW 7 105764156 missense probably benign 0.00
R1924:Dchs1 UTSW 7 105772280 missense possibly damaging 0.81
R1932:Dchs1 UTSW 7 105765902 missense probably damaging 1.00
R1962:Dchs1 UTSW 7 105764201 missense probably damaging 1.00
R1985:Dchs1 UTSW 7 105772398 missense possibly damaging 0.72
R1993:Dchs1 UTSW 7 105762548 missense probably benign 0.00
R2007:Dchs1 UTSW 7 105755325 missense probably damaging 1.00
R2316:Dchs1 UTSW 7 105764204 missense possibly damaging 0.71
R2351:Dchs1 UTSW 7 105754094 missense probably benign
R2474:Dchs1 UTSW 7 105755074 missense probably benign 0.37
R2474:Dchs1 UTSW 7 105772838 missense probably damaging 1.00
R3429:Dchs1 UTSW 7 105756504 missense possibly damaging 0.85
R3430:Dchs1 UTSW 7 105756504 missense possibly damaging 0.85
R3737:Dchs1 UTSW 7 105762316 missense possibly damaging 0.88
R3767:Dchs1 UTSW 7 105757085 missense possibly damaging 0.67
R3874:Dchs1 UTSW 7 105761635 missense probably damaging 1.00
R3883:Dchs1 UTSW 7 105762563 missense probably damaging 1.00
R4105:Dchs1 UTSW 7 105765140 missense probably damaging 1.00
R4209:Dchs1 UTSW 7 105766190 missense probably damaging 0.99
R4329:Dchs1 UTSW 7 105753759 missense probably damaging 1.00
R4516:Dchs1 UTSW 7 105754852 missense probably damaging 1.00
R4579:Dchs1 UTSW 7 105754765 missense probably damaging 1.00
R4579:Dchs1 UTSW 7 105758973 missense probably benign
R4588:Dchs1 UTSW 7 105756041 missense probably benign
R4613:Dchs1 UTSW 7 105772724 missense probably damaging 1.00
R4632:Dchs1 UTSW 7 105754355 missense probably benign 0.02
R4696:Dchs1 UTSW 7 105764627 missense probably damaging 1.00
R4725:Dchs1 UTSW 7 105755253 missense probably damaging 0.98
R4725:Dchs1 UTSW 7 105765552 missense probably damaging 1.00
R4738:Dchs1 UTSW 7 105758673 missense probably damaging 0.96
R4768:Dchs1 UTSW 7 105771620 missense possibly damaging 0.96
R4784:Dchs1 UTSW 7 105765926 missense probably damaging 1.00
R4864:Dchs1 UTSW 7 105755253 missense probably damaging 0.98
R4880:Dchs1 UTSW 7 105755730 missense probably benign 0.00
R4909:Dchs1 UTSW 7 105766255 missense probably damaging 1.00
R5102:Dchs1 UTSW 7 105772177 missense probably benign 0.09
R5109:Dchs1 UTSW 7 105765014 missense probably benign
R5126:Dchs1 UTSW 7 105753517 missense probably damaging 1.00
R5149:Dchs1 UTSW 7 105755658 missense probably damaging 0.98
R5330:Dchs1 UTSW 7 105754602 missense probably damaging 1.00
R5384:Dchs1 UTSW 7 105758029 missense probably damaging 1.00
R5384:Dchs1 UTSW 7 105772055 missense probably damaging 1.00
R5386:Dchs1 UTSW 7 105758029 missense probably damaging 1.00
R5622:Dchs1 UTSW 7 105755293 missense probably benign 0.11
R5623:Dchs1 UTSW 7 105772769 missense probably damaging 1.00
R5708:Dchs1 UTSW 7 105772809 missense probably damaging 1.00
R5718:Dchs1 UTSW 7 105755748 missense probably benign 0.01
R5743:Dchs1 UTSW 7 105771596 missense probably benign
R5759:Dchs1 UTSW 7 105764176 missense probably damaging 0.99
R5772:Dchs1 UTSW 7 105773040 missense probably damaging 1.00
R5860:Dchs1 UTSW 7 105772035 missense probably damaging 1.00
R5916:Dchs1 UTSW 7 105759166 missense probably damaging 1.00
R5965:Dchs1 UTSW 7 105755925 missense probably damaging 1.00
R5997:Dchs1 UTSW 7 105754095 missense probably benign 0.08
R6065:Dchs1 UTSW 7 105755421 missense probably damaging 1.00
R6136:Dchs1 UTSW 7 105760925 missense probably benign
R6137:Dchs1 UTSW 7 105765106 missense probably damaging 0.99
R6324:Dchs1 UTSW 7 105764938 missense probably benign 0.05
R6363:Dchs1 UTSW 7 105758472 missense probably benign 0.12
R6466:Dchs1 UTSW 7 105764541 missense probably benign 0.09
R6544:Dchs1 UTSW 7 105758178 missense probably damaging 1.00
R6572:Dchs1 UTSW 7 105758806 missense possibly damaging 0.94
R6579:Dchs1 UTSW 7 105762913 missense probably benign 0.17
R6632:Dchs1 UTSW 7 105761878 missense probably damaging 1.00
R6725:Dchs1 UTSW 7 105758793 missense probably damaging 0.99
R6789:Dchs1 UTSW 7 105757003 missense possibly damaging 0.61
R6868:Dchs1 UTSW 7 105763503 missense possibly damaging 0.91
R7058:Dchs1 UTSW 7 105757021 missense probably benign
R7064:Dchs1 UTSW 7 105763185 missense probably damaging 0.99
R7076:Dchs1 UTSW 7 105761871 missense probably benign 0.04
R7191:Dchs1 UTSW 7 105765439 missense possibly damaging 0.89
R7298:Dchs1 UTSW 7 105755131 nonsense probably null
R7380:Dchs1 UTSW 7 105758628 missense probably benign 0.35
R7438:Dchs1 UTSW 7 105754948 missense probably benign 0.30
R7496:Dchs1 UTSW 7 105761859 missense probably damaging 1.00
R7534:Dchs1 UTSW 7 105772373 missense probably benign 0.00
R7604:Dchs1 UTSW 7 105765982 missense probably damaging 1.00
R7631:Dchs1 UTSW 7 105759238 missense probably benign
R7821:Dchs1 UTSW 7 105765145 missense probably benign 0.00
R7834:Dchs1 UTSW 7 105765567 missense probably benign 0.39
R7841:Dchs1 UTSW 7 105762973 missense probably benign
R7913:Dchs1 UTSW 7 105759228 missense possibly damaging 0.61
R8041:Dchs1 UTSW 7 105755188 missense probably benign 0.45
R8076:Dchs1 UTSW 7 105755921 missense possibly damaging 0.52
R8076:Dchs1 UTSW 7 105761982 missense probably damaging 1.00
R8087:Dchs1 UTSW 7 105753499 missense probably benign 0.41
R8125:Dchs1 UTSW 7 105764882 missense possibly damaging 0.91
R8223:Dchs1 UTSW 7 105762617 missense possibly damaging 0.81
R8239:Dchs1 UTSW 7 105765511 missense probably benign 0.22
Z1177:Dchs1 UTSW 7 105757693 missense probably damaging 1.00
Z1177:Dchs1 UTSW 7 105758551 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGTTCAAGCAACACTAGGCAGC -3'
(R):5'- AGCCGTTCTCACGAGTCTAACTCC -3'

Sequencing Primer
(F):5'- AGGCAGCCCAGTGCTTG -3'
(R):5'- CTAGACCCTGGAGAATAGCTCTTG -3'
Posted On2013-05-09