Mutagenetix > Incidental Mutation

Incidental Mutation 'R4392:Anapc1'

326395

Institutional Source

Beutler Lab

Gene Symbol

Anapc1

Ensembl Gene

ENSMUSG00000014355

Gene Name

anaphase promoting complex subunit 1

Synonyms

2610021O03Rik, tsg24, Apc1, Mcpr

MMRRC Submission

041127-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4392 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

128610104-128687391 bp(-) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

T to C at 128676249 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000105962 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014499] [ENSMUST00000110333]

AlphaFold

P53995

Predicted Effect

probably null
Transcript: ENSMUST00000014499

SMART Domains

Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355

Domain	Start	End	E-Value	Type
Pfam:ANAPC1	150	214	1.7e-13	PFAM
low complexity region	323	345	N/A	INTRINSIC
low complexity region	1404	1415	N/A	INTRINSIC
Pfam:PC_rep	1467	1501	8.3e-8	PFAM
low complexity region	1516	1528	N/A	INTRINSIC
low complexity region	1924	1936	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000110333

SMART Domains

Protein: ENSMUSP00000105962
Gene: ENSMUSG00000014355

Domain	Start	End	E-Value	Type
Pfam:Apc1	149	227	1.7e-22	PFAM
low complexity region	323	345	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134485

Meta Mutation Damage Score

0.9486

Coding Region Coverage

1x: 99.5%
3x: 98.5%
10x: 96.1%
20x: 90.5%

Validation Efficiency

95% (69/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931414P19Rik	C	T	14: 54,584,978		probably null	Het
Abca13	A	C	11: 9,309,034	K2920T	possibly damaging	Het
Amy2b	T	G	3: 113,149,408		noncoding transcript	Het
Bmp7	T	G	2: 172,916,542	D178A	probably benign	Het
Brsk1	T	A	7: 4,698,750	I170N	probably damaging	Het
Bub3	C	T	7: 131,566,335	A187V	probably benign	Het
Cacna2d2	A	G	9: 107,400,280	H71R	possibly damaging	Het
Cdrt4	A	T	11: 62,951,353	K20N	probably benign	Het
Clec12a	A	T	6: 129,353,464		probably benign	Het
Col12a1	T	A	9: 79,662,488	Y1600F	probably damaging	Het
Cyp2a12	T	A	7: 27,029,275	I57N	probably damaging	Het
Dip2b	T	C	15: 100,162,036	L223P	probably damaging	Het
Dnah5	G	A	15: 28,289,229	R1188H	probably benign	Het
Dopey1	T	C	9: 86,503,143		probably benign	Het
Efcab5	T	A	11: 77,090,458	N1354I	probably damaging	Het
Eif4b	T	A	15: 102,086,641		probably null	Het
Elmsan1	A	T	12: 84,173,111	D356E	probably benign	Het
Erlec1	A	G	11: 30,943,697		probably null	Het
Esp24	T	C	17: 39,040,077		probably benign	Het
Esp34	T	C	17: 38,559,491	V24A	possibly damaging	Het
Fbxw15	T	A	9: 109,568,232		probably benign	Het
Foxc2	T	C	8: 121,117,452	S280P	probably damaging	Het
Gm21738	G	C	14: 19,417,178	L117V	probably benign	Het
Grk3	A	G	5: 112,920,136	F467S	probably damaging	Het
Grwd1	C	T	7: 45,827,780	G228S	probably damaging	Het
Gtf2i	T	C	5: 134,260,629	E399G	probably damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Lhx4	A	G	1: 155,710,134	Y83H	probably damaging	Het
Mdga1	T	C	17: 29,850,656	T413A	probably damaging	Het
Mmrn2	T	A	14: 34,397,616	L184H	probably damaging	Het
Mroh2a	C	T	1: 88,259,589	R133C	probably damaging	Het
Myh13	A	C	11: 67,344,881		probably null	Het
Nkain3	C	A	4: 20,282,985	R116L	possibly damaging	Het
Nxph2	A	C	2: 23,400,272	Q212P	probably damaging	Het
Olfr268-ps1	T	C	2: 111,844,345		noncoding transcript	Het
Olfr726	A	G	14: 50,084,603	F26S	probably benign	Het
Otog	T	C	7: 46,285,124	Y1369H	probably damaging	Het
Prl	A	G	13: 27,064,351	I131V	possibly damaging	Het
Ptprg	A	T	14: 12,142,467	I373F	possibly damaging	Het
Rad18	A	T	6: 112,693,529	C25S	probably damaging	Het
Rgs12	A	G	5: 35,032,311	T678A	probably damaging	Het
Scaper	T	A	9: 55,858,115	E557V	probably damaging	Het
Scube3	C	T	17: 28,164,788	P511L	probably null	Het
Sgpl1	A	G	10: 61,104,452		probably benign	Het
Slc10a1	C	A	12: 80,967,804	E47D	probably damaging	Het
Sptbn4	T	C	7: 27,418,471	N369S	probably damaging	Het
Sstr5	T	C	17: 25,491,224	T344A	probably benign	Het
Tgm4	C	T	9: 123,066,752	T631I	probably benign	Het
Tmprss15	A	G	16: 79,024,438	Y457H	probably damaging	Het
Trpm7	A	T	2: 126,848,538	W207R	probably damaging	Het
Trpm7	A	T	2: 126,795,509		probably null	Het
Ttc26	A	G	6: 38,381,557		probably benign	Het
Ugt1a1	CAGAGAGAGAGAGA	CAGAGAGAGAGA	1: 88,211,984		probably benign	Het
Ugt1a10	C	T	1: 88,215,123	P113L	probably damaging	Het
Usp2	A	T	9: 44,091,259	H384L	probably damaging	Het
Vmn2r27	C	T	6: 124,230,176	V169I	probably benign	Het
Vopp1	A	C	6: 57,762,476	F29C	probably damaging	Het
Wrn	T	C	8: 33,251,832	D953G	probably damaging	Het
Zfp759	T	A	13: 67,139,643	C419*	probably null	Het

Other mutations in Anapc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Anapc1	APN	2	128645130	splice site	probably benign
IGL00704:Anapc1	APN	2	128663984	missense	possibly damaging	0.48
IGL01023:Anapc1	APN	2	128629729	missense	probably damaging	1.00
IGL01432:Anapc1	APN	2	128633408	missense	probably damaging	1.00
IGL01549:Anapc1	APN	2	128653170	missense	probably benign
IGL02089:Anapc1	APN	2	128663933	missense	probably damaging	1.00
IGL02275:Anapc1	APN	2	128659852	missense	probably benign
IGL02570:Anapc1	APN	2	128645200	missense	probably damaging	1.00
IGL02597:Anapc1	APN	2	128623931	missense	probably benign	0.02
IGL02726:Anapc1	APN	2	128659785	missense	probably benign	0.05
IGL03265:Anapc1	APN	2	128627197	missense	probably damaging	1.00
IGL03304:Anapc1	APN	2	128627113	splice site	probably benign
IGL03327:Anapc1	APN	2	128623934	missense	probably benign	0.00
R0023:Anapc1	UTSW	2	128678218	missense	probably damaging	0.99
R0027:Anapc1	UTSW	2	128641511	missense	possibly damaging	0.96
R0027:Anapc1	UTSW	2	128641511	missense	possibly damaging	0.96
R0084:Anapc1	UTSW	2	128623966	splice site	probably benign
R0103:Anapc1	UTSW	2	128680452	splice site	probably benign
R0103:Anapc1	UTSW	2	128680452	splice site	probably benign
R0109:Anapc1	UTSW	2	128634693	missense	probably damaging	1.00
R0109:Anapc1	UTSW	2	128634693	missense	probably damaging	1.00
R0241:Anapc1	UTSW	2	128628629	missense	possibly damaging	0.89
R0241:Anapc1	UTSW	2	128628629	missense	possibly damaging	0.89
R0255:Anapc1	UTSW	2	128634711	missense	probably damaging	0.99
R0377:Anapc1	UTSW	2	128641340	critical splice donor site	probably null
R0467:Anapc1	UTSW	2	128669043	missense	probably damaging	0.99
R0514:Anapc1	UTSW	2	128632655	missense	probably damaging	0.99
R0591:Anapc1	UTSW	2	128619332	missense	probably benign	0.17
R0919:Anapc1	UTSW	2	128617731	missense	probably benign
R1175:Anapc1	UTSW	2	128680188	missense	probably damaging	1.00
R1473:Anapc1	UTSW	2	128617697	missense	possibly damaging	0.88
R1547:Anapc1	UTSW	2	128617556	missense	probably benign	0.44
R1556:Anapc1	UTSW	2	128624899	missense	probably benign	0.00
R1567:Anapc1	UTSW	2	128617716	missense	probably damaging	1.00
R1635:Anapc1	UTSW	2	128628532	missense	probably damaging	1.00
R1645:Anapc1	UTSW	2	128658246	critical splice donor site	probably null
R1677:Anapc1	UTSW	2	128676208	missense	probably benign	0.09
R1854:Anapc1	UTSW	2	128675890	missense	probably damaging	1.00
R1856:Anapc1	UTSW	2	128659788	missense	probably damaging	0.96
R1959:Anapc1	UTSW	2	128633415	missense	probably benign	0.36
R1984:Anapc1	UTSW	2	128669688	missense	possibly damaging	0.85
R2034:Anapc1	UTSW	2	128648458	missense	possibly damaging	0.92
R2283:Anapc1	UTSW	2	128642548	missense	probably benign	0.23
R2928:Anapc1	UTSW	2	128680137	missense	probably damaging	1.00
R3547:Anapc1	UTSW	2	128642682	missense	possibly damaging	0.58
R3904:Anapc1	UTSW	2	128642519	missense	probably damaging	1.00
R4156:Anapc1	UTSW	2	128627229	intron	probably benign
R4359:Anapc1	UTSW	2	128623556	missense	possibly damaging	0.64
R4574:Anapc1	UTSW	2	128627195	missense	probably damaging	1.00
R4682:Anapc1	UTSW	2	128664005	missense	probably benign	0.05
R4770:Anapc1	UTSW	2	128686060	splice site	probably benign
R4824:Anapc1	UTSW	2	128628690	missense	possibly damaging	0.69
R4960:Anapc1	UTSW	2	128684594	missense	probably benign	0.23
R5016:Anapc1	UTSW	2	128607175	unclassified	probably benign
R5063:Anapc1	UTSW	2	128629549	missense	possibly damaging	0.48
R5128:Anapc1	UTSW	2	128659917	missense	probably benign
R5271:Anapc1	UTSW	2	128685985	nonsense	probably null
R5363:Anapc1	UTSW	2	128650194	critical splice donor site	probably null
R5469:Anapc1	UTSW	2	128675701	nonsense	probably null
R5473:Anapc1	UTSW	2	128607195	unclassified	probably benign
R5559:Anapc1	UTSW	2	128680434	nonsense	probably null
R5631:Anapc1	UTSW	2	128657217	missense	possibly damaging	0.85
R5747:Anapc1	UTSW	2	128624916	missense	probably benign	0.19
R5840:Anapc1	UTSW	2	128607037	unclassified	probably benign
R6226:Anapc1	UTSW	2	128650372	missense	probably damaging	1.00
R6526:Anapc1	UTSW	2	128672135	nonsense	probably null
R6561:Anapc1	UTSW	2	128663999	missense	probably damaging	0.98
R6743:Anapc1	UTSW	2	128684534	nonsense	probably null
R6799:Anapc1	UTSW	2	128659737	missense	probably null	0.38
R6887:Anapc1	UTSW	2	128659768	missense	possibly damaging	0.91
R6978:Anapc1	UTSW	2	128669900	missense	probably benign	0.06
R7011:Anapc1	UTSW	2	128648681	splice site	probably null
R7041:Anapc1	UTSW	2	128628656	missense	possibly damaging	0.88
R7047:Anapc1	UTSW	2	128615430	missense	probably damaging	0.96
R7074:Anapc1	UTSW	2	128678274	missense	probably damaging	1.00
R7109:Anapc1	UTSW	2	128674602	missense	probably benign	0.33
R7123:Anapc1	UTSW	2	128613010	missense	probably damaging	1.00
R7309:Anapc1	UTSW	2	128674684	missense	probably damaging	0.96
R7693:Anapc1	UTSW	2	128641537	missense	possibly damaging	0.86
R7839:Anapc1	UTSW	2	128684608	missense	probably damaging	0.99
R7847:Anapc1	UTSW	2	128669908	missense	possibly damaging	0.93
R7960:Anapc1	UTSW	2	128674593	missense	probably damaging	1.00
R8061:Anapc1	UTSW	2	128648488	missense	probably damaging	0.98
R8127:Anapc1	UTSW	2	128632627	missense	probably damaging	0.96
R8228:Anapc1	UTSW	2	128619917	nonsense	probably null
R8402:Anapc1	UTSW	2	128630228	missense	probably benign	0.02
R8422:Anapc1	UTSW	2	128675837	missense	probably benign
R8425:Anapc1	UTSW	2	128669868	missense	probably damaging	1.00
R8469:Anapc1	UTSW	2	128658344	splice site	probably null
R8553:Anapc1	UTSW	2	128619913	missense	possibly damaging	0.80
R8688:Anapc1	UTSW	2	128685828	missense	probably benign	0.19
R8699:Anapc1	UTSW	2	128641453	missense	probably damaging	1.00
R8719:Anapc1	UTSW	2	128641449	missense	probably damaging	1.00
R8775:Anapc1	UTSW	2	128657173	missense	possibly damaging	0.92
R8775-TAIL:Anapc1	UTSW	2	128657173	missense	possibly damaging	0.92
R8806:Anapc1	UTSW	2	128622413	missense	possibly damaging	0.67
R8973:Anapc1	UTSW	2	128664032	missense	probably damaging	0.99
R8977:Anapc1	UTSW	2	128641402	missense	probably damaging	1.00
R9000:Anapc1	UTSW	2	128634708	missense	probably damaging	1.00
R9080:Anapc1	UTSW	2	128622506	missense	possibly damaging	0.82
R9203:Anapc1	UTSW	2	128623502	missense	possibly damaging	0.66
R9314:Anapc1	UTSW	2	128622500	missense	possibly damaging	0.69
R9386:Anapc1	UTSW	2	128617722	missense	probably benign	0.08
R9415:Anapc1	UTSW	2	128634678	missense	probably benign
R9436:Anapc1	UTSW	2	128676125	missense	probably benign
R9516:Anapc1	UTSW	2	128675713	missense	possibly damaging	0.77
R9563:Anapc1	UTSW	2	128664060	nonsense	probably null
R9572:Anapc1	UTSW	2	128664056	missense	probably benign
R9757:Anapc1	UTSW	2	128675756	missense	probably damaging	1.00
R9766:Anapc1	UTSW	2	128658301	missense	probably damaging	1.00
X0066:Anapc1	UTSW	2	128674701	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- GCATGATCAGTCACCCTTACC -3'
(R):5'- AGATGTATGTGTGTCAGAGTGGAAC -3'

Sequencing Primer
(F):5'- ATGATCAGTCACCCTTACCTCTGG -3'
(R):5'- GTTTAATGCAGTTAAGGAAGTTGAC -3'

Posted On

2015-07-06