Incidental Mutation 'R4392:Nkain3'
ID 326398
Institutional Source Beutler Lab
Gene Symbol Nkain3
Ensembl Gene ENSMUSG00000055761
Gene Name Na+/K+ transporting ATPase interacting 3
Synonyms E130310K16Rik
MMRRC Submission 041127-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.091) question?
Stock # R4392 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 20118874-20778866 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 20282985 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 116 (R116L)
Ref Sequence ENSEMBL: ENSMUSP00000113113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102998] [ENSMUST00000119374]
AlphaFold Q3URJ8
Predicted Effect possibly damaging
Transcript: ENSMUST00000102998
AA Change: R116L

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000100063
Gene: ENSMUSG00000055761
AA Change: R116L

DomainStartEndE-ValueType
Pfam:NKAIN 1 162 1e-85 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000119374
AA Change: R116L

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113113
Gene: ENSMUSG00000055761
AA Change: R116L

DomainStartEndE-ValueType
Pfam:NKAIN 1 180 7e-83 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.5%
  • 10x: 96.1%
  • 20x: 90.5%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NKAIN3 is a member of a family of mammalian proteins (see NKAIN1; MIM 612871) with similarity to Drosophila Nkain (Gorokhova et al., 2007 [PubMed 17606467]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik C T 14: 54,822,435 (GRCm39) probably null Het
Abca13 A C 11: 9,259,034 (GRCm39) K2920T possibly damaging Het
Amy2b T G 3: 113,056,724 (GRCm39) noncoding transcript Het
Anapc1 T C 2: 128,518,169 (GRCm39) probably null Het
Bmp7 T G 2: 172,758,335 (GRCm39) D178A probably benign Het
Brsk1 T A 7: 4,701,749 (GRCm39) I170N probably damaging Het
Bub3 C T 7: 131,168,064 (GRCm39) A187V probably benign Het
Cacna2d2 A G 9: 107,277,479 (GRCm39) H71R possibly damaging Het
Cdrt4 A T 11: 62,842,179 (GRCm39) K20N probably benign Het
Clec12a A T 6: 129,330,427 (GRCm39) probably benign Het
Col12a1 T A 9: 79,569,770 (GRCm39) Y1600F probably damaging Het
Cyp2a12 T A 7: 26,728,700 (GRCm39) I57N probably damaging Het
Dip2b T C 15: 100,059,917 (GRCm39) L223P probably damaging Het
Dnah5 G A 15: 28,289,375 (GRCm39) R1188H probably benign Het
Dop1a T C 9: 86,385,196 (GRCm39) probably benign Het
Efcab5 T A 11: 76,981,284 (GRCm39) N1354I probably damaging Het
Eif4b T A 15: 101,995,076 (GRCm39) probably null Het
Erlec1 A G 11: 30,893,697 (GRCm39) probably null Het
Esp24 T C 17: 39,350,968 (GRCm39) probably benign Het
Esp34 T C 17: 38,870,382 (GRCm39) V24A possibly damaging Het
Fbxw15 T A 9: 109,397,300 (GRCm39) probably benign Het
Foxc2 T C 8: 121,844,191 (GRCm39) S280P probably damaging Het
Gm21738 G C 14: 19,417,178 (GRCm38) L117V probably benign Het
Grk3 A G 5: 113,068,002 (GRCm39) F467S probably damaging Het
Grwd1 C T 7: 45,477,204 (GRCm39) G228S probably damaging Het
Gtf2i T C 5: 134,289,483 (GRCm39) E399G probably damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Homer3 G A 8: 70,742,793 (GRCm39) probably null Het
Ift56 A G 6: 38,358,492 (GRCm39) probably benign Het
Lhx4 A G 1: 155,585,880 (GRCm39) Y83H probably damaging Het
Mdga1 T C 17: 30,069,630 (GRCm39) T413A probably damaging Het
Mideas A T 12: 84,219,885 (GRCm39) D356E probably benign Het
Mmrn2 T A 14: 34,119,573 (GRCm39) L184H probably damaging Het
Mroh2a C T 1: 88,187,311 (GRCm39) R133C probably damaging Het
Myh13 A C 11: 67,235,707 (GRCm39) probably null Het
Nxph2 A C 2: 23,290,284 (GRCm39) Q212P probably damaging Het
Or4f7d-ps1 T C 2: 111,674,690 (GRCm39) noncoding transcript Het
Or4k15c A G 14: 50,322,060 (GRCm39) F26S probably benign Het
Otog T C 7: 45,934,548 (GRCm39) Y1369H probably damaging Het
Prl A G 13: 27,248,334 (GRCm39) I131V possibly damaging Het
Ptprg A T 14: 12,142,467 (GRCm38) I373F possibly damaging Het
Rad18 A T 6: 112,670,490 (GRCm39) C25S probably damaging Het
Rgs12 A G 5: 35,189,655 (GRCm39) T678A probably damaging Het
Scaper T A 9: 55,765,399 (GRCm39) E557V probably damaging Het
Scube3 C T 17: 28,383,762 (GRCm39) P511L probably null Het
Sgpl1 A G 10: 60,940,231 (GRCm39) probably benign Het
Slc10a1 C A 12: 81,014,578 (GRCm39) E47D probably damaging Het
Sptbn4 T C 7: 27,117,896 (GRCm39) N369S probably damaging Het
Sstr5 T C 17: 25,710,198 (GRCm39) T344A probably benign Het
Tgm4 C T 9: 122,895,817 (GRCm39) T631I probably benign Het
Tmprss15 A G 16: 78,821,326 (GRCm39) Y457H probably damaging Het
Trpm7 A T 2: 126,637,429 (GRCm39) probably null Het
Trpm7 A T 2: 126,690,458 (GRCm39) W207R probably damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,139,706 (GRCm39) probably benign Het
Ugt1a10 C T 1: 88,142,845 (GRCm39) P113L probably damaging Het
Usp2 A T 9: 44,002,556 (GRCm39) H384L probably damaging Het
Vmn2r27 C T 6: 124,207,135 (GRCm39) V169I probably benign Het
Vopp1 A C 6: 57,739,461 (GRCm39) F29C probably damaging Het
Wrn T C 8: 33,741,860 (GRCm39) D953G probably damaging Het
Zfp759 T A 13: 67,287,707 (GRCm39) C419* probably null Het
Other mutations in Nkain3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02610:Nkain3 APN 4 20,469,459 (GRCm39) missense probably damaging 1.00
I1329:Nkain3 UTSW 4 20,158,329 (GRCm39) splice site probably benign
IGL03055:Nkain3 UTSW 4 20,778,308 (GRCm39) missense probably benign 0.01
R0726:Nkain3 UTSW 4 20,158,388 (GRCm39) missense possibly damaging 0.67
R1485:Nkain3 UTSW 4 20,484,932 (GRCm39) missense probably damaging 1.00
R1600:Nkain3 UTSW 4 20,469,528 (GRCm39) splice site probably benign
R1702:Nkain3 UTSW 4 20,158,339 (GRCm39) critical splice donor site probably null
R3707:Nkain3 UTSW 4 20,484,920 (GRCm39) missense possibly damaging 0.65
R4192:Nkain3 UTSW 4 20,485,003 (GRCm39) nonsense probably null
R4410:Nkain3 UTSW 4 20,778,284 (GRCm39) missense probably benign 0.20
R4721:Nkain3 UTSW 4 20,485,015 (GRCm39) missense probably damaging 0.98
R5333:Nkain3 UTSW 4 20,484,889 (GRCm39) missense probably benign 0.04
R5978:Nkain3 UTSW 4 20,485,026 (GRCm39) splice site probably null
R7208:Nkain3 UTSW 4 20,282,892 (GRCm39) missense probably benign 0.01
R8921:Nkain3 UTSW 4 20,245,902 (GRCm39) missense unknown
R9090:Nkain3 UTSW 4 20,484,897 (GRCm39) missense probably damaging 1.00
R9271:Nkain3 UTSW 4 20,484,897 (GRCm39) missense probably damaging 1.00
R9374:Nkain3 UTSW 4 20,778,431 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- ATCTGAAGCATTCACTACCTACCAG -3'
(R):5'- GGCTCTTGATGTGTAGCAACC -3'

Sequencing Primer
(F):5'- GCATTCACTACCTACCAGATAAAAG -3'
(R):5'- CTCTTGATGTGTAGCAACCTTACAAG -3'
Posted On 2015-07-06