Incidental Mutation 'R4392:Grk3'
ID326400
Institutional Source Beutler Lab
Gene Symbol Grk3
Ensembl Gene ENSMUSG00000042249
Gene NameG protein-coupled receptor kinase 3
Synonyms4833444A01Rik, Bark-2, Adrbk-2, Adrbk2, beta ARK2
MMRRC Submission 041127-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4392 (G1)
Quality Score177
Status Validated
Chromosome5
Chromosomal Location112910482-113015791 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112920136 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 467 (F467S)
Ref Sequence ENSEMBL: ENSMUSP00000142968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065167] [ENSMUST00000197888] [ENSMUST00000200332]
Predicted Effect probably damaging
Transcript: ENSMUST00000065167
AA Change: F509S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070445
Gene: ENSMUSG00000042249
AA Change: F509S

DomainStartEndE-ValueType
RGS 54 175 1.44e-28 SMART
S_TKc 191 453 8.94e-85 SMART
S_TK_X 454 530 2.19e-10 SMART
PH 559 654 8.45e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195928
Predicted Effect probably damaging
Transcript: ENSMUST00000197888
AA Change: F467S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142968
Gene: ENSMUSG00000042249
AA Change: F467S

DomainStartEndE-ValueType
RGS 12 133 1.44e-28 SMART
S_TKc 149 411 8.94e-85 SMART
S_TK_X 412 488 2.19e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199337
Predicted Effect probably benign
Transcript: ENSMUST00000200332
SMART Domains Protein: ENSMUSP00000142926
Gene: ENSMUSG00000042249

DomainStartEndE-ValueType
PDB:3V5W|A 1 88 6e-42 PDB
SCOP:d1dk8a_ 48 88 2e-4 SMART
Blast:RGS 54 88 1e-18 BLAST
Meta Mutation Damage Score 0.8947 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.5%
  • 10x: 96.1%
  • 20x: 90.5%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The beta-adrenergic receptor kinase specifically phosphorylates the agonist-occupied form of the beta-adrenergic and related G protein-coupled receptors. Overall, the beta adrenergic receptor kinase 2 has 85% amino acid similarity with beta adrenergic receptor kinase 1, with the protein kinase catalytic domain having 95% similarity. These data suggest the existence of a family of receptor kinases which may serve broadly to regulate receptor function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Animals homozygous for a mutation of this gene appear normal and are fertile, but exhibit a lack of odorant receptor-mediated desensitization in the olfactory epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik C T 14: 54,584,978 probably null Het
Abca13 A C 11: 9,309,034 K2920T possibly damaging Het
Amy2b T G 3: 113,149,408 noncoding transcript Het
Anapc1 T C 2: 128,676,249 probably null Het
Bmp7 T G 2: 172,916,542 D178A probably benign Het
Brsk1 T A 7: 4,698,750 I170N probably damaging Het
Bub3 C T 7: 131,566,335 A187V probably benign Het
Cacna2d2 A G 9: 107,400,280 H71R possibly damaging Het
Cdrt4 A T 11: 62,951,353 K20N probably benign Het
Clec12a A T 6: 129,353,464 probably benign Het
Col12a1 T A 9: 79,662,488 Y1600F probably damaging Het
Cyp2a12 T A 7: 27,029,275 I57N probably damaging Het
Dip2b T C 15: 100,162,036 L223P probably damaging Het
Dnah5 G A 15: 28,289,229 R1188H probably benign Het
Dopey1 T C 9: 86,503,143 probably benign Het
Efcab5 T A 11: 77,090,458 N1354I probably damaging Het
Eif4b T A 15: 102,086,641 probably null Het
Elmsan1 A T 12: 84,173,111 D356E probably benign Het
Erlec1 A G 11: 30,943,697 probably null Het
Esp24 T C 17: 39,040,077 probably benign Het
Esp34 T C 17: 38,559,491 V24A possibly damaging Het
Fbxw15 T A 9: 109,568,232 probably benign Het
Foxc2 T C 8: 121,117,452 S280P probably damaging Het
Gm21738 G C 14: 19,417,178 L117V probably benign Het
Grwd1 C T 7: 45,827,780 G228S probably damaging Het
Gtf2i T C 5: 134,260,629 E399G probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Homer3 G A 8: 70,290,143 probably null Het
Lhx4 A G 1: 155,710,134 Y83H probably damaging Het
Mdga1 T C 17: 29,850,656 T413A probably damaging Het
Mmrn2 T A 14: 34,397,616 L184H probably damaging Het
Mroh2a C T 1: 88,259,589 R133C probably damaging Het
Myh13 A C 11: 67,344,881 probably null Het
Nkain3 C A 4: 20,282,985 R116L possibly damaging Het
Nxph2 A C 2: 23,400,272 Q212P probably damaging Het
Olfr268-ps1 T C 2: 111,844,345 noncoding transcript Het
Olfr726 A G 14: 50,084,603 F26S probably benign Het
Otog T C 7: 46,285,124 Y1369H probably damaging Het
Prl A G 13: 27,064,351 I131V possibly damaging Het
Ptprg A T 14: 12,142,467 I373F possibly damaging Het
Rad18 A T 6: 112,693,529 C25S probably damaging Het
Rgs12 A G 5: 35,032,311 T678A probably damaging Het
Scaper T A 9: 55,858,115 E557V probably damaging Het
Scube3 C T 17: 28,164,788 P511L probably null Het
Sgpl1 A G 10: 61,104,452 probably benign Het
Slc10a1 C A 12: 80,967,804 E47D probably damaging Het
Sptbn4 T C 7: 27,418,471 N369S probably damaging Het
Sstr5 T C 17: 25,491,224 T344A probably benign Het
Tgm4 C T 9: 123,066,752 T631I probably benign Het
Tmprss15 A G 16: 79,024,438 Y457H probably damaging Het
Trpm7 A T 2: 126,795,509 probably null Het
Trpm7 A T 2: 126,848,538 W207R probably damaging Het
Ttc26 A G 6: 38,381,557 probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Usp2 A T 9: 44,091,259 H384L probably damaging Het
Vmn2r27 C T 6: 124,230,176 V169I probably benign Het
Vopp1 A C 6: 57,762,476 F29C probably damaging Het
Wrn T C 8: 33,251,832 D953G probably damaging Het
Zfp759 T A 13: 67,139,643 C419* probably null Het
Other mutations in Grk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00974:Grk3 APN 5 112985819 missense probably damaging 1.00
IGL01359:Grk3 APN 5 112937760 missense probably damaging 1.00
IGL02318:Grk3 APN 5 112937803 missense probably damaging 1.00
IGL02612:Grk3 APN 5 112969234 missense probably benign 0.27
R0142:Grk3 UTSW 5 112915053 missense probably damaging 1.00
R0589:Grk3 UTSW 5 112928763 splice site probably benign
R0607:Grk3 UTSW 5 112920053 missense probably damaging 1.00
R1459:Grk3 UTSW 5 112915012 missense probably benign 0.10
R1554:Grk3 UTSW 5 112969269 missense possibly damaging 0.76
R1640:Grk3 UTSW 5 113015382 missense probably benign 0.36
R1657:Grk3 UTSW 5 112966982 missense probably damaging 1.00
R1789:Grk3 UTSW 5 112941718 missense probably damaging 1.00
R2401:Grk3 UTSW 5 112914983 missense probably benign
R3735:Grk3 UTSW 5 112953831 missense probably benign 0.00
R4024:Grk3 UTSW 5 112914984 missense possibly damaging 0.77
R4025:Grk3 UTSW 5 112914984 missense possibly damaging 0.77
R4439:Grk3 UTSW 5 112946677 splice site probably null
R4589:Grk3 UTSW 5 112941718 missense possibly damaging 0.87
R4646:Grk3 UTSW 5 112929720 missense probably benign 0.04
R5154:Grk3 UTSW 5 112941717 missense probably damaging 1.00
R5462:Grk3 UTSW 5 112969208 missense probably damaging 1.00
R5764:Grk3 UTSW 5 112966910 critical splice donor site probably null
R5790:Grk3 UTSW 5 112966976 missense possibly damaging 0.80
R6516:Grk3 UTSW 5 112961549 intron probably benign
R6848:Grk3 UTSW 5 112985775 missense probably damaging 0.98
R7857:Grk3 UTSW 5 112961561 missense unknown
R7873:Grk3 UTSW 5 112929686 missense probably benign 0.03
R8029:Grk3 UTSW 5 112961642 missense probably benign
R8132:Grk3 UTSW 5 112961489 missense unknown
R8903:Grk3 UTSW 5 112918831 missense possibly damaging 0.89
RF021:Grk3 UTSW 5 112941688 missense probably benign 0.20
Z1176:Grk3 UTSW 5 112957314 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CATCCACCTGGTGACTCCAATC -3'
(R):5'- TGATGCTATTGACGGCCAG -3'

Sequencing Primer
(F):5'- TGGTGACTCCAATCCACGTAAAAC -3'
(R):5'- TCCCTGAATGTGGTCATG -3'
Posted On2015-07-06