Incidental Mutation 'R4392:Wrn'
ID 326414
Institutional Source Beutler Lab
Gene Symbol Wrn
Ensembl Gene ENSMUSG00000031583
Gene Name Werner syndrome RecQ like helicase
Synonyms
MMRRC Submission 041127-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.301) question?
Stock # R4392 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 33724412-33875555 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 33741860 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 953 (D953G)
Ref Sequence ENSEMBL: ENSMUSP00000147379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033990] [ENSMUST00000033991] [ENSMUST00000211498]
AlphaFold O09053
Predicted Effect probably damaging
Transcript: ENSMUST00000033990
AA Change: D1196G

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000033990
Gene: ENSMUSG00000031583
AA Change: D1196G

DomainStartEndE-ValueType
35EXOc 47 226 1e-47 SMART
low complexity region 484 489 N/A INTRINSIC
DEXDc 509 704 2.3e-28 SMART
HELICc 743 824 3.7e-27 SMART
RQC 923 1028 3.1e-28 SMART
HRDC 1115 1194 1.5e-26 SMART
low complexity region 1205 1216 N/A INTRINSIC
Pfam:HTH_40 1222 1318 2.7e-9 PFAM
low complexity region 1342 1356 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000033991
AA Change: D1196G

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000033991
Gene: ENSMUSG00000031583
AA Change: D1196G

DomainStartEndE-ValueType
35EXOc 47 226 1.1e-47 SMART
low complexity region 484 489 N/A INTRINSIC
DEXDc 509 704 2.4e-28 SMART
HELICc 743 824 3.7e-27 SMART
Pfam:RecQ_Zn_bind 835 905 2.2e-8 PFAM
RQC 923 1028 3.2e-28 SMART
HRDC 1115 1194 1.5e-26 SMART
low complexity region 1205 1216 N/A INTRINSIC
Pfam:HTH_40 1223 1317 4.3e-10 PFAM
low complexity region 1342 1356 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211498
AA Change: D953G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.4052 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.5%
  • 10x: 96.1%
  • 20x: 90.5%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RecQ subfamily and the DEAH (Asp-Glu-Ala-His) subfamily of DNA and RNA helicases. DNA helicases are involved in many aspects of DNA metabolism, including transcription, replication, recombination, and repair. This protein contains a nuclear localization signal in the C-terminus and shows a predominant nucleolar localization. It possesses an intrinsic 3' to 5' DNA helicase activity, and is also a 3' to 5' exonuclease. Based on interactions between this protein and Ku70/80 heterodimer in DNA end processing, this protein may be involved in the repair of double strand DNA breaks. Defects in this gene are the cause of Werner syndrome, an autosomal recessive disorder characterized by premature aging. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show enhanced frequency and variety of tumors in conjunction with Trp53 knockout alleles. Homozygotes also have an elevated frequency of somatic reversion of the pink-eyed dilution unstable mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik C T 14: 54,822,435 (GRCm39) probably null Het
Abca13 A C 11: 9,259,034 (GRCm39) K2920T possibly damaging Het
Amy2b T G 3: 113,056,724 (GRCm39) noncoding transcript Het
Anapc1 T C 2: 128,518,169 (GRCm39) probably null Het
Bmp7 T G 2: 172,758,335 (GRCm39) D178A probably benign Het
Brsk1 T A 7: 4,701,749 (GRCm39) I170N probably damaging Het
Bub3 C T 7: 131,168,064 (GRCm39) A187V probably benign Het
Cacna2d2 A G 9: 107,277,479 (GRCm39) H71R possibly damaging Het
Cdrt4 A T 11: 62,842,179 (GRCm39) K20N probably benign Het
Clec12a A T 6: 129,330,427 (GRCm39) probably benign Het
Col12a1 T A 9: 79,569,770 (GRCm39) Y1600F probably damaging Het
Cyp2a12 T A 7: 26,728,700 (GRCm39) I57N probably damaging Het
Dip2b T C 15: 100,059,917 (GRCm39) L223P probably damaging Het
Dnah5 G A 15: 28,289,375 (GRCm39) R1188H probably benign Het
Dop1a T C 9: 86,385,196 (GRCm39) probably benign Het
Efcab5 T A 11: 76,981,284 (GRCm39) N1354I probably damaging Het
Eif4b T A 15: 101,995,076 (GRCm39) probably null Het
Erlec1 A G 11: 30,893,697 (GRCm39) probably null Het
Esp24 T C 17: 39,350,968 (GRCm39) probably benign Het
Esp34 T C 17: 38,870,382 (GRCm39) V24A possibly damaging Het
Fbxw15 T A 9: 109,397,300 (GRCm39) probably benign Het
Foxc2 T C 8: 121,844,191 (GRCm39) S280P probably damaging Het
Gm21738 G C 14: 19,417,178 (GRCm38) L117V probably benign Het
Grk3 A G 5: 113,068,002 (GRCm39) F467S probably damaging Het
Grwd1 C T 7: 45,477,204 (GRCm39) G228S probably damaging Het
Gtf2i T C 5: 134,289,483 (GRCm39) E399G probably damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Homer3 G A 8: 70,742,793 (GRCm39) probably null Het
Ift56 A G 6: 38,358,492 (GRCm39) probably benign Het
Lhx4 A G 1: 155,585,880 (GRCm39) Y83H probably damaging Het
Mdga1 T C 17: 30,069,630 (GRCm39) T413A probably damaging Het
Mideas A T 12: 84,219,885 (GRCm39) D356E probably benign Het
Mmrn2 T A 14: 34,119,573 (GRCm39) L184H probably damaging Het
Mroh2a C T 1: 88,187,311 (GRCm39) R133C probably damaging Het
Myh13 A C 11: 67,235,707 (GRCm39) probably null Het
Nkain3 C A 4: 20,282,985 (GRCm39) R116L possibly damaging Het
Nxph2 A C 2: 23,290,284 (GRCm39) Q212P probably damaging Het
Or4f7d-ps1 T C 2: 111,674,690 (GRCm39) noncoding transcript Het
Or4k15c A G 14: 50,322,060 (GRCm39) F26S probably benign Het
Otog T C 7: 45,934,548 (GRCm39) Y1369H probably damaging Het
Prl A G 13: 27,248,334 (GRCm39) I131V possibly damaging Het
Ptprg A T 14: 12,142,467 (GRCm38) I373F possibly damaging Het
Rad18 A T 6: 112,670,490 (GRCm39) C25S probably damaging Het
Rgs12 A G 5: 35,189,655 (GRCm39) T678A probably damaging Het
Scaper T A 9: 55,765,399 (GRCm39) E557V probably damaging Het
Scube3 C T 17: 28,383,762 (GRCm39) P511L probably null Het
Sgpl1 A G 10: 60,940,231 (GRCm39) probably benign Het
Slc10a1 C A 12: 81,014,578 (GRCm39) E47D probably damaging Het
Sptbn4 T C 7: 27,117,896 (GRCm39) N369S probably damaging Het
Sstr5 T C 17: 25,710,198 (GRCm39) T344A probably benign Het
Tgm4 C T 9: 122,895,817 (GRCm39) T631I probably benign Het
Tmprss15 A G 16: 78,821,326 (GRCm39) Y457H probably damaging Het
Trpm7 A T 2: 126,637,429 (GRCm39) probably null Het
Trpm7 A T 2: 126,690,458 (GRCm39) W207R probably damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,139,706 (GRCm39) probably benign Het
Ugt1a10 C T 1: 88,142,845 (GRCm39) P113L probably damaging Het
Usp2 A T 9: 44,002,556 (GRCm39) H384L probably damaging Het
Vmn2r27 C T 6: 124,207,135 (GRCm39) V169I probably benign Het
Vopp1 A C 6: 57,739,461 (GRCm39) F29C probably damaging Het
Zfp759 T A 13: 67,287,707 (GRCm39) C419* probably null Het
Other mutations in Wrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Wrn APN 8 33,812,405 (GRCm39) splice site probably benign
IGL00661:Wrn APN 8 33,809,173 (GRCm39) splice site probably benign
IGL01472:Wrn APN 8 33,819,200 (GRCm39) missense possibly damaging 0.93
IGL01544:Wrn APN 8 33,814,554 (GRCm39) missense probably benign 0.00
IGL01599:Wrn APN 8 33,731,039 (GRCm39) missense possibly damaging 0.69
IGL01688:Wrn APN 8 33,800,730 (GRCm39) splice site probably benign
IGL01916:Wrn APN 8 33,747,252 (GRCm39) missense possibly damaging 0.78
IGL01925:Wrn APN 8 33,809,208 (GRCm39) missense probably benign 0.42
IGL02068:Wrn APN 8 33,800,777 (GRCm39) missense probably benign 0.38
IGL02084:Wrn APN 8 33,775,207 (GRCm39) missense probably benign
IGL02167:Wrn APN 8 33,807,583 (GRCm39) missense probably damaging 1.00
IGL02230:Wrn APN 8 33,807,591 (GRCm39) missense probably damaging 1.00
IGL02717:Wrn APN 8 33,833,601 (GRCm39) missense probably damaging 1.00
IGL02982:Wrn APN 8 33,833,094 (GRCm39) missense probably damaging 1.00
IGL03030:Wrn APN 8 33,738,989 (GRCm39) missense possibly damaging 0.94
IGL03088:Wrn APN 8 33,758,851 (GRCm39) splice site probably benign
IGL03179:Wrn APN 8 33,800,734 (GRCm39) splice site probably null
IGL03306:Wrn APN 8 33,826,149 (GRCm39) missense probably damaging 1.00
R0004:Wrn UTSW 8 33,807,588 (GRCm39) missense probably damaging 1.00
R0190:Wrn UTSW 8 33,731,011 (GRCm39) missense probably benign 0.02
R0441:Wrn UTSW 8 33,758,778 (GRCm39) missense probably benign 0.24
R0463:Wrn UTSW 8 33,770,843 (GRCm39) missense possibly damaging 0.84
R0538:Wrn UTSW 8 33,826,119 (GRCm39) missense probably damaging 0.99
R0682:Wrn UTSW 8 33,757,848 (GRCm39) missense probably benign 0.00
R0729:Wrn UTSW 8 33,738,946 (GRCm39) splice site probably null
R0744:Wrn UTSW 8 33,785,034 (GRCm39) missense possibly damaging 0.91
R0836:Wrn UTSW 8 33,785,034 (GRCm39) missense possibly damaging 0.91
R1168:Wrn UTSW 8 33,806,436 (GRCm39) missense probably damaging 1.00
R1301:Wrn UTSW 8 33,782,714 (GRCm39) missense probably damaging 1.00
R1352:Wrn UTSW 8 33,784,944 (GRCm39) missense probably benign 0.25
R1396:Wrn UTSW 8 33,758,847 (GRCm39) missense probably damaging 1.00
R1432:Wrn UTSW 8 33,809,169 (GRCm39) splice site probably benign
R1523:Wrn UTSW 8 33,782,744 (GRCm39) missense probably benign 0.23
R1625:Wrn UTSW 8 33,819,158 (GRCm39) missense probably benign 0.01
R1664:Wrn UTSW 8 33,770,794 (GRCm39) splice site probably null
R1773:Wrn UTSW 8 33,833,589 (GRCm39) missense probably damaging 1.00
R1864:Wrn UTSW 8 33,778,892 (GRCm39) missense probably damaging 0.99
R1868:Wrn UTSW 8 33,747,249 (GRCm39) missense probably benign 0.03
R2011:Wrn UTSW 8 33,726,432 (GRCm39) missense probably benign 0.02
R2075:Wrn UTSW 8 33,812,357 (GRCm39) missense probably benign 0.00
R2091:Wrn UTSW 8 33,757,853 (GRCm39) missense probably benign
R2213:Wrn UTSW 8 33,747,043 (GRCm39) missense probably benign 0.05
R2255:Wrn UTSW 8 33,819,230 (GRCm39) missense probably benign 0.13
R2276:Wrn UTSW 8 33,814,584 (GRCm39) missense probably benign 0.02
R3177:Wrn UTSW 8 33,807,582 (GRCm39) missense probably damaging 1.00
R3277:Wrn UTSW 8 33,807,582 (GRCm39) missense probably damaging 1.00
R3779:Wrn UTSW 8 33,731,048 (GRCm39) missense probably damaging 1.00
R3827:Wrn UTSW 8 33,814,548 (GRCm39) missense probably benign 0.00
R4111:Wrn UTSW 8 33,842,183 (GRCm39) missense probably benign 0.02
R4458:Wrn UTSW 8 33,785,026 (GRCm39) missense probably damaging 0.99
R4650:Wrn UTSW 8 33,745,537 (GRCm39) missense probably benign 0.05
R4656:Wrn UTSW 8 33,826,019 (GRCm39) splice site probably null
R4657:Wrn UTSW 8 33,826,019 (GRCm39) splice site probably null
R4667:Wrn UTSW 8 33,814,366 (GRCm39) missense probably benign 0.00
R4735:Wrn UTSW 8 33,775,250 (GRCm39) missense probably damaging 1.00
R4933:Wrn UTSW 8 33,812,371 (GRCm39) missense probably benign 0.01
R5104:Wrn UTSW 8 33,757,895 (GRCm39) splice site probably null
R5166:Wrn UTSW 8 33,842,100 (GRCm39) critical splice donor site probably null
R5279:Wrn UTSW 8 33,731,129 (GRCm39) missense probably damaging 1.00
R5400:Wrn UTSW 8 33,784,945 (GRCm39) missense probably benign 0.02
R5575:Wrn UTSW 8 33,826,158 (GRCm39) missense probably benign 0.02
R5695:Wrn UTSW 8 33,814,346 (GRCm39) missense probably benign 0.26
R5729:Wrn UTSW 8 33,758,806 (GRCm39) missense probably benign 0.02
R6044:Wrn UTSW 8 33,726,457 (GRCm39) missense probably damaging 1.00
R6139:Wrn UTSW 8 33,843,360 (GRCm39) missense probably damaging 1.00
R6158:Wrn UTSW 8 33,809,200 (GRCm39) missense probably damaging 1.00
R6192:Wrn UTSW 8 33,774,682 (GRCm39) missense probably benign 0.12
R6243:Wrn UTSW 8 33,774,682 (GRCm39) missense possibly damaging 0.94
R6354:Wrn UTSW 8 33,833,666 (GRCm39) missense possibly damaging 0.93
R6429:Wrn UTSW 8 33,833,024 (GRCm39) missense probably damaging 1.00
R6490:Wrn UTSW 8 33,809,248 (GRCm39) missense probably benign 0.01
R6529:Wrn UTSW 8 33,826,004 (GRCm39) splice site probably null
R6535:Wrn UTSW 8 33,826,131 (GRCm39) missense probably damaging 0.99
R7001:Wrn UTSW 8 33,842,157 (GRCm39) missense probably benign 0.04
R7114:Wrn UTSW 8 33,775,149 (GRCm39) frame shift probably null
R7198:Wrn UTSW 8 33,814,346 (GRCm39) missense probably benign 0.00
R7200:Wrn UTSW 8 33,812,376 (GRCm39) missense probably benign 0.00
R7227:Wrn UTSW 8 33,738,974 (GRCm39) missense probably damaging 1.00
R7299:Wrn UTSW 8 33,782,746 (GRCm39) missense probably damaging 1.00
R7374:Wrn UTSW 8 33,758,939 (GRCm39) missense probably damaging 1.00
R7402:Wrn UTSW 8 33,738,994 (GRCm39) missense probably benign 0.00
R7404:Wrn UTSW 8 33,738,994 (GRCm39) missense probably benign 0.00
R7405:Wrn UTSW 8 33,738,994 (GRCm39) missense probably benign 0.00
R7464:Wrn UTSW 8 33,826,024 (GRCm39) critical splice donor site probably null
R7474:Wrn UTSW 8 33,819,209 (GRCm39) missense probably damaging 0.96
R7609:Wrn UTSW 8 33,800,741 (GRCm39) missense possibly damaging 0.50
R7729:Wrn UTSW 8 33,814,454 (GRCm39) missense probably benign 0.21
R7830:Wrn UTSW 8 33,759,082 (GRCm39) missense probably damaging 0.97
R7998:Wrn UTSW 8 33,782,671 (GRCm39) missense probably benign 0.10
R8239:Wrn UTSW 8 33,819,213 (GRCm39) missense probably damaging 1.00
R8262:Wrn UTSW 8 33,814,274 (GRCm39) missense probably benign 0.07
R8410:Wrn UTSW 8 33,759,048 (GRCm39) missense probably damaging 1.00
R8480:Wrn UTSW 8 33,778,796 (GRCm39) missense probably benign 0.10
R8530:Wrn UTSW 8 33,770,852 (GRCm39) missense possibly damaging 0.83
R8540:Wrn UTSW 8 33,842,154 (GRCm39) missense probably damaging 0.96
R8708:Wrn UTSW 8 33,782,671 (GRCm39) missense probably damaging 0.96
R8783:Wrn UTSW 8 33,826,041 (GRCm39) missense probably null 1.00
R8870:Wrn UTSW 8 33,819,220 (GRCm39) missense probably benign 0.01
R8876:Wrn UTSW 8 33,814,422 (GRCm39) missense probably benign 0.00
R9050:Wrn UTSW 8 33,833,021 (GRCm39) missense probably damaging 1.00
R9329:Wrn UTSW 8 33,731,006 (GRCm39) missense probably benign
R9595:Wrn UTSW 8 33,758,961 (GRCm39) missense probably benign
R9621:Wrn UTSW 8 33,814,301 (GRCm39) missense probably benign 0.01
R9623:Wrn UTSW 8 33,774,644 (GRCm39) critical splice donor site probably null
R9797:Wrn UTSW 8 33,758,950 (GRCm39) missense probably benign 0.02
RF010:Wrn UTSW 8 33,778,793 (GRCm39) missense probably benign 0.13
X0017:Wrn UTSW 8 33,770,810 (GRCm39) missense probably damaging 1.00
Z1176:Wrn UTSW 8 33,824,237 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACAGCTTCAACCCTGAAAAGTTG -3'
(R):5'- TGAGAAAGTTTGTCGCATGC -3'

Sequencing Primer
(F):5'- TCAACCCTGAAAAGTTGAGAAAAC -3'
(R):5'- GAGAAAGTTTGTCGCATGCTCTTAAG -3'
Posted On 2015-07-06