Mutagenetix > Incidental Mutation

Incidental Mutation 'R4392:Col12a1'

326418

Institutional Source

Beutler Lab

Gene Symbol

Col12a1

Ensembl Gene

ENSMUSG00000032332

Gene Name

collagen, type XII, alpha 1

Synonyms

MMRRC Submission

041127-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.768) question?

Stock #

R4392 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

79598991-79718831 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 79662488 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 1600 (Y1600F)

Ref Sequence

ENSEMBL: ENSMUSP00000112604 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071750] [ENSMUST00000121227]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000071750
AA Change: Y1600F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000071662
Gene: ENSMUSG00000032332
AA Change: Y1600F

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
FN3	25	103	2.29e-10	SMART
low complexity region	114	129	N/A	INTRINSIC
VWA	138	317	4e-63	SMART
FN3	334	413	1.47e-8	SMART
VWA	438	617	2.41e-57	SMART
FN3	632	710	1.62e-10	SMART
FN3	723	801	2.91e-12	SMART
FN3	814	892	6.05e-10	SMART
FN3	905	984	2.74e-8	SMART
FN3	995	1074	1.24e-6	SMART
FN3	1087	1166	5.78e-7	SMART
VWA	1197	1376	2.02e-59	SMART
FN3	1385	1463	1.13e-9	SMART
FN3	1474	1554	1.07e-10	SMART
FN3	1566	1643	3.73e-10	SMART
FN3	1655	1734	2.94e-8	SMART
FN3	1755	1834	1.54e-11	SMART
FN3	1846	1924	1.45e-7	SMART
FN3	1936	2015	1.47e-8	SMART
FN3	2027	2106	1.21e-9	SMART
FN3	2118	2195	2.14e-10	SMART
FN3	2206	2285	3.85e-3	SMART
low complexity region	2292	2314	N/A	INTRINSIC
VWA	2323	2503	2.61e-53	SMART
TSPN	2522	2714	1.13e-76	SMART
Pfam:Collagen	2747	2804	1.7e-8	PFAM
Pfam:Collagen	2802	2855	6.5e-9	PFAM
Pfam:Collagen	2844	2904	1.1e-9	PFAM
Pfam:Collagen	2939	2994	4.6e-8	PFAM
low complexity region	3011	3044	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000121227
AA Change: Y1600F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112604
Gene: ENSMUSG00000032332
AA Change: Y1600F

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
FN3	25	103	2.29e-10	SMART
low complexity region	114	129	N/A	INTRINSIC
VWA	138	317	4e-63	SMART
FN3	334	413	1.47e-8	SMART
VWA	438	617	2.41e-57	SMART
FN3	632	710	1.62e-10	SMART
FN3	723	801	2.91e-12	SMART
FN3	814	892	6.05e-10	SMART
FN3	905	984	2.74e-8	SMART
FN3	995	1074	1.24e-6	SMART
FN3	1087	1166	5.78e-7	SMART
VWA	1197	1376	2.02e-59	SMART
FN3	1385	1463	1.13e-9	SMART
FN3	1474	1554	1.07e-10	SMART
FN3	1566	1643	3.73e-10	SMART
FN3	1655	1734	2.94e-8	SMART
FN3	1755	1834	1.54e-11	SMART
FN3	1846	1924	1.45e-7	SMART
FN3	1936	2015	1.47e-8	SMART
FN3	2027	2106	1.21e-9	SMART
FN3	2118	2195	2.14e-10	SMART
FN3	2206	2285	3.85e-3	SMART
low complexity region	2292	2314	N/A	INTRINSIC
VWA	2323	2503	2.61e-53	SMART
TSPN	2522	2714	1.13e-76	SMART
Pfam:Collagen	2747	2804	4.7e-9	PFAM
Pfam:Collagen	2802	2861	2.9e-9	PFAM
Pfam:Collagen	2838	2900	7.1e-8	PFAM
Pfam:Collagen	2935	2990	1.3e-8	PFAM
low complexity region	3007	3040	N/A	INTRINSIC

Meta Mutation Damage Score

0.1945

Coding Region Coverage

1x: 99.5%
3x: 98.5%
10x: 96.1%
20x: 90.5%

Validation Efficiency

95% (69/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XII collagen, a member of the FACIT (fibril-associated collagens with interrupted triple helices) collagen family. Type XII collagen is a homotrimer found in association with type I collagen, an association that is thought to modify the interactions between collagen I fibrils and the surrounding matrix. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial perinatal lethality, decreased body weight, shorter and slender long bones, altered vertebrae structure, kyphosis, decreased bone strength, and abnormalities in osteoblast differentiation and bone matrix formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931414P19Rik	C	T	14: 54,584,978		probably null	Het
Abca13	A	C	11: 9,309,034	K2920T	possibly damaging	Het
Amy2b	T	G	3: 113,149,408		noncoding transcript	Het
Anapc1	T	C	2: 128,676,249		probably null	Het
Bmp7	T	G	2: 172,916,542	D178A	probably benign	Het
Brsk1	T	A	7: 4,698,750	I170N	probably damaging	Het
Bub3	C	T	7: 131,566,335	A187V	probably benign	Het
Cacna2d2	A	G	9: 107,400,280	H71R	possibly damaging	Het
Cdrt4	A	T	11: 62,951,353	K20N	probably benign	Het
Clec12a	A	T	6: 129,353,464		probably benign	Het
Cyp2a12	T	A	7: 27,029,275	I57N	probably damaging	Het
Dip2b	T	C	15: 100,162,036	L223P	probably damaging	Het
Dnah5	G	A	15: 28,289,229	R1188H	probably benign	Het
Dopey1	T	C	9: 86,503,143		probably benign	Het
Efcab5	T	A	11: 77,090,458	N1354I	probably damaging	Het
Eif4b	T	A	15: 102,086,641		probably null	Het
Elmsan1	A	T	12: 84,173,111	D356E	probably benign	Het
Erlec1	A	G	11: 30,943,697		probably null	Het
Esp24	T	C	17: 39,040,077		probably benign	Het
Esp34	T	C	17: 38,559,491	V24A	possibly damaging	Het
Fbxw15	T	A	9: 109,568,232		probably benign	Het
Foxc2	T	C	8: 121,117,452	S280P	probably damaging	Het
Gm21738	G	C	14: 19,417,178	L117V	probably benign	Het
Grk3	A	G	5: 112,920,136	F467S	probably damaging	Het
Grwd1	C	T	7: 45,827,780	G228S	probably damaging	Het
Gtf2i	T	C	5: 134,260,629	E399G	probably damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Lhx4	A	G	1: 155,710,134	Y83H	probably damaging	Het
Mdga1	T	C	17: 29,850,656	T413A	probably damaging	Het
Mmrn2	T	A	14: 34,397,616	L184H	probably damaging	Het
Mroh2a	C	T	1: 88,259,589	R133C	probably damaging	Het
Myh13	A	C	11: 67,344,881		probably null	Het
Nkain3	C	A	4: 20,282,985	R116L	possibly damaging	Het
Nxph2	A	C	2: 23,400,272	Q212P	probably damaging	Het
Olfr268-ps1	T	C	2: 111,844,345		noncoding transcript	Het
Olfr726	A	G	14: 50,084,603	F26S	probably benign	Het
Otog	T	C	7: 46,285,124	Y1369H	probably damaging	Het
Prl	A	G	13: 27,064,351	I131V	possibly damaging	Het
Ptprg	A	T	14: 12,142,467	I373F	possibly damaging	Het
Rad18	A	T	6: 112,693,529	C25S	probably damaging	Het
Rgs12	A	G	5: 35,032,311	T678A	probably damaging	Het
Scaper	T	A	9: 55,858,115	E557V	probably damaging	Het
Scube3	C	T	17: 28,164,788	P511L	probably null	Het
Sgpl1	A	G	10: 61,104,452		probably benign	Het
Slc10a1	C	A	12: 80,967,804	E47D	probably damaging	Het
Sptbn4	T	C	7: 27,418,471	N369S	probably damaging	Het
Sstr5	T	C	17: 25,491,224	T344A	probably benign	Het
Tgm4	C	T	9: 123,066,752	T631I	probably benign	Het
Tmprss15	A	G	16: 79,024,438	Y457H	probably damaging	Het
Trpm7	A	T	2: 126,795,509		probably null	Het
Trpm7	A	T	2: 126,848,538	W207R	probably damaging	Het
Ttc26	A	G	6: 38,381,557		probably benign	Het
Ugt1a1	CAGAGAGAGAGAGA	CAGAGAGAGAGA	1: 88,211,984		probably benign	Het
Ugt1a10	C	T	1: 88,215,123	P113L	probably damaging	Het
Usp2	A	T	9: 44,091,259	H384L	probably damaging	Het
Vmn2r27	C	T	6: 124,230,176	V169I	probably benign	Het
Vopp1	A	C	6: 57,762,476	F29C	probably damaging	Het
Wrn	T	C	8: 33,251,832	D953G	probably damaging	Het
Zfp759	T	A	13: 67,139,643	C419*	probably null	Het

Other mutations in Col12a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Col12a1	APN	9	79681537	missense	possibly damaging	0.55
IGL00434:Col12a1	APN	9	79653332	missense	probably benign	0.27
IGL00465:Col12a1	APN	9	79697581	missense	probably damaging	1.00
IGL00568:Col12a1	APN	9	79651477	missense	probably damaging	1.00
IGL00576:Col12a1	APN	9	79647652	missense	probably damaging	1.00
IGL00580:Col12a1	APN	9	79692226	missense	probably benign	0.05
IGL01015:Col12a1	APN	9	79633741	missense	probably damaging	1.00
IGL01124:Col12a1	APN	9	79703847	missense	probably damaging	1.00
IGL01138:Col12a1	APN	9	79678053	missense	probably damaging	1.00
IGL01295:Col12a1	APN	9	79643926	missense	probably damaging	1.00
IGL01630:Col12a1	APN	9	79657366	missense	probably damaging	1.00
IGL01648:Col12a1	APN	9	79601169	makesense	probably null
IGL01878:Col12a1	APN	9	79649975	missense	possibly damaging	0.72
IGL01921:Col12a1	APN	9	79650017	missense	possibly damaging	0.50
IGL02064:Col12a1	APN	9	79692372	missense	probably benign	0.06
IGL02123:Col12a1	APN	9	79662458	critical splice donor site	probably null
IGL02312:Col12a1	APN	9	79681515	missense	probably damaging	1.00
IGL02320:Col12a1	APN	9	79616021	critical splice donor site	probably null
IGL02328:Col12a1	APN	9	79682066	missense	probably damaging	1.00
IGL02342:Col12a1	APN	9	79649896	splice site	probably null
IGL02355:Col12a1	APN	9	79630711	splice site	probably benign
IGL02362:Col12a1	APN	9	79630711	splice site	probably benign
IGL02396:Col12a1	APN	9	79662583	missense	probably benign
IGL02449:Col12a1	APN	9	79641469	missense	probably damaging	1.00
IGL02682:Col12a1	APN	9	79699341	missense	probably damaging	1.00
IGL02751:Col12a1	APN	9	79613859	unclassified	probably benign
IGL02801:Col12a1	APN	9	79608414	splice site	probably null
IGL03001:Col12a1	APN	9	79633673	missense	probably damaging	1.00
IGL03027:Col12a1	APN	9	79641551	missense	probably benign	0.40
IGL03090:Col12a1	APN	9	79678370	missense	probably damaging	1.00
IGL03115:Col12a1	APN	9	79681437	missense	probably damaging	1.00
IGL03220:Col12a1	APN	9	79699483	missense	probably damaging	1.00
IGL03240:Col12a1	APN	9	79678383	splice site	probably null
IGL03348:Col12a1	APN	9	79693430	missense	possibly damaging	0.88
airship	UTSW	9	79706337	missense	possibly damaging	0.65
dirigible	UTSW	9	79703829	missense	possibly damaging	0.73
Feast	UTSW	9	79700262	missense	probably benign	0.00
hardly	UTSW	9	79700350	nonsense	probably null
hearty	UTSW	9	79643966	missense	probably damaging	1.00
Hefty	UTSW	9	79662454	splice site	probably benign
P0045:Col12a1	UTSW	9	79647611	missense	probably damaging	0.99
PIT4260001:Col12a1	UTSW	9	79651380	critical splice donor site	probably null
PIT4280001:Col12a1	UTSW	9	79678105	missense	probably damaging	1.00
R0015:Col12a1	UTSW	9	79651385	missense	probably damaging	1.00
R0015:Col12a1	UTSW	9	79651385	missense	probably damaging	1.00
R0240:Col12a1	UTSW	9	79652033	missense	probably benign	0.02
R0276:Col12a1	UTSW	9	79630741	nonsense	probably null
R0309:Col12a1	UTSW	9	79600011	splice site	probably null
R0336:Col12a1	UTSW	9	79702345	missense	probably damaging	0.98
R0376:Col12a1	UTSW	9	79693494	missense	probably benign	0.10
R0413:Col12a1	UTSW	9	79699360	missense	probably damaging	0.99
R0504:Col12a1	UTSW	9	79681468	missense	possibly damaging	0.90
R0542:Col12a1	UTSW	9	79605328	critical splice donor site	probably null
R0610:Col12a1	UTSW	9	79707848	missense	probably benign
R0631:Col12a1	UTSW	9	79703376	missense	probably damaging	1.00
R0637:Col12a1	UTSW	9	79656735	missense	probably benign	0.00
R0667:Col12a1	UTSW	9	79628462	missense	probably damaging	1.00
R0711:Col12a1	UTSW	9	79652035	missense	probably damaging	1.00
R0717:Col12a1	UTSW	9	79612419	missense	probably damaging	1.00
R0762:Col12a1	UTSW	9	79681374	splice site	probably benign
R0787:Col12a1	UTSW	9	79638485	missense	probably damaging	0.99
R0890:Col12a1	UTSW	9	79700402	missense	probably damaging	0.97
R0900:Col12a1	UTSW	9	79684253	missense	possibly damaging	0.91
R1109:Col12a1	UTSW	9	79699723	missense	probably damaging	1.00
R1264:Col12a1	UTSW	9	79620089	missense	probably benign	0.09
R1321:Col12a1	UTSW	9	79617709	nonsense	probably null
R1344:Col12a1	UTSW	9	79699555	nonsense	probably null
R1387:Col12a1	UTSW	9	79681375	splice site	probably benign
R1511:Col12a1	UTSW	9	79699552	missense	probably benign	0.02
R1523:Col12a1	UTSW	9	79660996	missense	probably benign	0.01
R1526:Col12a1	UTSW	9	79656798	missense	probably benign	0.44
R1564:Col12a1	UTSW	9	79613840	missense	probably damaging	1.00
R1595:Col12a1	UTSW	9	79602254	missense	probably damaging	1.00
R1603:Col12a1	UTSW	9	79612962	missense	probably damaging	1.00
R1673:Col12a1	UTSW	9	79693538	missense	probably benign	0.00
R1730:Col12a1	UTSW	9	79628378	missense	possibly damaging	0.93
R1737:Col12a1	UTSW	9	79703451	missense	probably damaging	1.00
R1739:Col12a1	UTSW	9	79633468	missense	probably damaging	0.98
R1748:Col12a1	UTSW	9	79672997	missense	probably benign	0.01
R1778:Col12a1	UTSW	9	79604585	splice site	probably benign
R1845:Col12a1	UTSW	9	79697541	missense	probably benign	0.09
R1864:Col12a1	UTSW	9	79627103	splice site	probably null
R1876:Col12a1	UTSW	9	79678281	nonsense	probably null
R1934:Col12a1	UTSW	9	79604522	nonsense	probably null
R1942:Col12a1	UTSW	9	79635466	missense	probably damaging	1.00
R1950:Col12a1	UTSW	9	79630549	missense	possibly damaging	0.62
R2027:Col12a1	UTSW	9	79645793	critical splice acceptor site	probably null
R2061:Col12a1	UTSW	9	79617705	missense	possibly damaging	0.88
R2064:Col12a1	UTSW	9	79662454	splice site	probably benign
R2070:Col12a1	UTSW	9	79647696	missense	probably benign	0.00
R2112:Col12a1	UTSW	9	79643899	missense	possibly damaging	0.93
R2209:Col12a1	UTSW	9	79692352	missense	possibly damaging	0.83
R2275:Col12a1	UTSW	9	79635427	missense	probably damaging	0.99
R2330:Col12a1	UTSW	9	79633657	missense	probably damaging	0.99
R2373:Col12a1	UTSW	9	79656813	missense	probably benign	0.03
R2425:Col12a1	UTSW	9	79678366	missense	probably damaging	1.00
R2428:Col12a1	UTSW	9	79602251	missense	probably benign	0.30
R2437:Col12a1	UTSW	9	79692219	missense	probably damaging	0.97
R2831:Col12a1	UTSW	9	79697401	missense	probably null	0.99
R2851:Col12a1	UTSW	9	79678332	missense	probably damaging	1.00
R2872:Col12a1	UTSW	9	79699549	missense	probably damaging	1.00
R2872:Col12a1	UTSW	9	79699549	missense	probably damaging	1.00
R2874:Col12a1	UTSW	9	79699549	missense	probably damaging	1.00
R2904:Col12a1	UTSW	9	79652025	missense	probably damaging	1.00
R2905:Col12a1	UTSW	9	79652025	missense	probably damaging	1.00
R2991:Col12a1	UTSW	9	79700265	missense	probably damaging	1.00
R3402:Col12a1	UTSW	9	79643947	missense	probably damaging	1.00
R3429:Col12a1	UTSW	9	79680311	missense	probably benign
R3430:Col12a1	UTSW	9	79680311	missense	probably benign
R3547:Col12a1	UTSW	9	79633416	missense	probably damaging	1.00
R3789:Col12a1	UTSW	9	79639723	missense	possibly damaging	0.96
R4091:Col12a1	UTSW	9	79702364	missense	probably damaging	0.99
R4328:Col12a1	UTSW	9	79700389	missense	possibly damaging	0.91
R4382:Col12a1	UTSW	9	79630741	nonsense	probably null
R4405:Col12a1	UTSW	9	79639965	critical splice donor site	probably null
R4465:Col12a1	UTSW	9	79672910	missense	possibly damaging	0.62
R4521:Col12a1	UTSW	9	79633357	missense	probably benign	0.00
R4612:Col12a1	UTSW	9	79616057	missense	probably damaging	0.99
R4613:Col12a1	UTSW	9	79647601	missense	probably benign	0.03
R4649:Col12a1	UTSW	9	79639794	missense	probably damaging	1.00
R4651:Col12a1	UTSW	9	79612946	missense	probably damaging	1.00
R4652:Col12a1	UTSW	9	79612946	missense	probably damaging	1.00
R4738:Col12a1	UTSW	9	79699282	missense	probably damaging	1.00
R4745:Col12a1	UTSW	9	79652086	splice site	probably null
R4761:Col12a1	UTSW	9	79657310	missense	probably benign	0.34
R4784:Col12a1	UTSW	9	79678494	missense	possibly damaging	0.50
R4785:Col12a1	UTSW	9	79678494	missense	possibly damaging	0.50
R4809:Col12a1	UTSW	9	79693567	missense	probably benign	0.10
R4821:Col12a1	UTSW	9	79715340	intron	probably benign
R4925:Col12a1	UTSW	9	79674795	missense	probably damaging	1.00
R4938:Col12a1	UTSW	9	79700350	nonsense	probably null
R5034:Col12a1	UTSW	9	79657367	missense	probably damaging	1.00
R5133:Col12a1	UTSW	9	79605174	missense	probably damaging	0.99
R5138:Col12a1	UTSW	9	79643966	missense	probably damaging	1.00
R5145:Col12a1	UTSW	9	79706300	missense	probably benign	0.00
R5152:Col12a1	UTSW	9	79656748	missense	probably damaging	1.00
R5237:Col12a1	UTSW	9	79700262	missense	probably benign	0.00
R5268:Col12a1	UTSW	9	79678047	missense	probably damaging	0.99
R5328:Col12a1	UTSW	9	79620060	missense	probably damaging	0.96
R5372:Col12a1	UTSW	9	79678366	missense	probably damaging	1.00
R5440:Col12a1	UTSW	9	79614363	missense	probably benign	0.07
R5496:Col12a1	UTSW	9	79602185	splice site	probably benign
R5537:Col12a1	UTSW	9	79699590	missense	probably damaging	1.00
R5596:Col12a1	UTSW	9	79703759	missense	probably damaging	1.00
R5677:Col12a1	UTSW	9	79699321	missense	probably damaging	1.00
R5715:Col12a1	UTSW	9	79616065	nonsense	probably null
R5796:Col12a1	UTSW	9	79703829	missense	possibly damaging	0.73
R5829:Col12a1	UTSW	9	79633673	missense	probably damaging	1.00
R5865:Col12a1	UTSW	9	79604478	missense	probably benign	0.00
R5919:Col12a1	UTSW	9	79602298	missense	probably damaging	0.99
R5974:Col12a1	UTSW	9	79682127	missense	probably damaging	0.99
R5981:Col12a1	UTSW	9	79678506	missense	probably damaging	0.99
R5982:Col12a1	UTSW	9	79630560	missense	probably damaging	1.00
R6027:Col12a1	UTSW	9	79656578	critical splice donor site	probably null
R6090:Col12a1	UTSW	9	79692393	missense	probably damaging	1.00
R6293:Col12a1	UTSW	9	79614358	missense	probably benign	0.00
R6393:Col12a1	UTSW	9	79655485	missense	probably damaging	0.99
R6457:Col12a1	UTSW	9	79645691	missense	probably damaging	1.00
R6505:Col12a1	UTSW	9	79647605	missense	probably damaging	0.98
R6508:Col12a1	UTSW	9	79649949	missense	probably damaging	1.00
R6620:Col12a1	UTSW	9	79620049	missense	probably damaging	0.98
R6718:Col12a1	UTSW	9	79699605	missense	probably damaging	1.00
R6752:Col12a1	UTSW	9	79633424	missense	possibly damaging	0.72
R6774:Col12a1	UTSW	9	79706337	missense	possibly damaging	0.65
R6872:Col12a1	UTSW	9	79677234	missense	probably damaging	1.00
R6884:Col12a1	UTSW	9	79639809	missense	possibly damaging	0.92
R6935:Col12a1	UTSW	9	79700500	missense	possibly damaging	0.76
R7198:Col12a1	UTSW	9	79650032	missense	possibly damaging	0.56
R7296:Col12a1	UTSW	9	79682066	missense	probably damaging	1.00
R7365:Col12a1	UTSW	9	79706360	missense	probably damaging	0.99
R7466:Col12a1	UTSW	9	79655407	missense	possibly damaging	0.95
R7516:Col12a1	UTSW	9	79612910	splice site	probably null
R7584:Col12a1	UTSW	9	79703296	critical splice donor site	probably null
R7624:Col12a1	UTSW	9	79645794	splice site	probably null
R7670:Col12a1	UTSW	9	79631643	missense	probably damaging	1.00
R7678:Col12a1	UTSW	9	79651486	missense	probably damaging	0.99
R7702:Col12a1	UTSW	9	79681521	missense	probably damaging	1.00
R7796:Col12a1	UTSW	9	79678551	missense	possibly damaging	0.88
R7902:Col12a1	UTSW	9	79641581	missense	probably benign	0.00
R7923:Col12a1	UTSW	9	79678493	missense	probably benign	0.00
R7986:Col12a1	UTSW	9	79604392	critical splice donor site	probably null
R8004:Col12a1	UTSW	9	79684401	missense	probably damaging	1.00
R8046:Col12a1	UTSW	9	79706226	critical splice donor site	probably null
R8056:Col12a1	UTSW	9	79599938	missense
R8151:Col12a1	UTSW	9	79630549	missense	possibly damaging	0.62
R8203:Col12a1	UTSW	9	79681549	missense	possibly damaging	0.94
R8221:Col12a1	UTSW	9	79643942	missense	probably damaging	1.00
R8294:Col12a1	UTSW	9	79699312	missense	possibly damaging	0.91
R8309:Col12a1	UTSW	9	79605183	missense	possibly damaging	0.68
R8319:Col12a1	UTSW	9	79648697	missense	probably damaging	0.97
R8351:Col12a1	UTSW	9	79681412	missense	probably damaging	0.97
R8442:Col12a1	UTSW	9	79635499	missense	probably damaging	1.00
R8500:Col12a1	UTSW	9	79609851	missense	probably damaging	1.00
R8682:Col12a1	UTSW	9	79661076	missense	probably benign	0.03
R8700:Col12a1	UTSW	9	79620089	missense	probably benign	0.09
R8859:Col12a1	UTSW	9	79680399	nonsense	probably null
R8898:Col12a1	UTSW	9	79692295	missense	probably benign	0.08
R8930:Col12a1	UTSW	9	79673383	missense	probably benign
R8932:Col12a1	UTSW	9	79673383	missense	probably benign
R8949:Col12a1	UTSW	9	79674688	missense	probably benign	0.17
R8962:Col12a1	UTSW	9	79631619	missense	probably damaging	1.00
R9045:Col12a1	UTSW	9	79674752	missense	probably benign	0.00
R9080:Col12a1	UTSW	9	79609851	missense	probably benign	0.06
R9145:Col12a1	UTSW	9	79620062	missense	probably benign	0.16
R9163:Col12a1	UTSW	9	79641447	critical splice donor site	probably null
R9168:Col12a1	UTSW	9	79641501	nonsense	probably null
R9188:Col12a1	UTSW	9	79602332	missense	probably benign	0.22
R9258:Col12a1	UTSW	9	79706363	missense	probably benign	0.04
R9292:Col12a1	UTSW	9	79678523	missense	probably benign	0.33
R9345:Col12a1	UTSW	9	79633735	missense	probably benign	0.08
R9382:Col12a1	UTSW	9	79682082	missense	probably benign	0.23
R9427:Col12a1	UTSW	9	79682163	missense	probably benign	0.15
R9601:Col12a1	UTSW	9	79617752	missense	probably damaging	0.98
R9653:Col12a1	UTSW	9	79677274	missense	probably benign
R9668:Col12a1	UTSW	9	79639678	nonsense	probably null
R9762:Col12a1	UTSW	9	79619984	missense	possibly damaging	0.82
X0021:Col12a1	UTSW	9	79608485	missense	probably damaging	1.00
X0058:Col12a1	UTSW	9	79602224	missense	possibly damaging	0.66
X0061:Col12a1	UTSW	9	79612392	splice site	probably null
Z1177:Col12a1	UTSW	9	79599986	missense	possibly damaging	0.80
Z1177:Col12a1	UTSW	9	79639696	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- GTTTTGACTGCACAAGTTTTCTGTC -3'
(R):5'- GGACTGGGAGATTGTCATGTAAAC -3'

Sequencing Primer
(F):5'- GCACAAGTTTTCTGTCTTTCATTAAC -3'
(R):5'- TGGATCCCCAAGTTCAAGGCTAG -3'

Posted On

2015-07-06