Mutagenetix > Incidental Mutation

Incidental Mutation 'R4392:Dopey1'

326419

Institutional Source

Beutler Lab

Gene Symbol

Dopey1

Ensembl Gene

ENSMUSG00000034973

Gene Name

dopey family member 1

Synonyms

B130005I07Rik, D9Ertd809e

MMRRC Submission

041127-MU

Accession Numbers

Genbank: NM_177208; MGI: 1289294

Essential gene?

Possibly non essential (E-score: 0.289) question?

Stock #

R4392 (G1)

Quality Score

219

Status

Validated

Chromosome

Chromosomal Location

86467154-86555923 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

T to C at 86503143 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000140740 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034987] [ENSMUST00000185919] [ENSMUST00000188675] [ENSMUST00000190957]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000034987

SMART Domains

Protein: ENSMUSP00000034987
Gene: ENSMUSG00000034973

Domain	Start	End	E-Value	Type
Pfam:Dopey_N	11	300	1e-117	PFAM
low complexity region	631	649	N/A	INTRINSIC
low complexity region	961	973	N/A	INTRINSIC
low complexity region	1073	1084	N/A	INTRINSIC
low complexity region	1105	1118	N/A	INTRINSIC
low complexity region	1268	1281	N/A	INTRINSIC
low complexity region	1296	1318	N/A	INTRINSIC
low complexity region	1335	1344	N/A	INTRINSIC
low complexity region	1362	1373	N/A	INTRINSIC
low complexity region	1575	1589	N/A	INTRINSIC
low complexity region	2217	2227	N/A	INTRINSIC
low complexity region	2351	2362	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185840

Predicted Effect

probably benign
Transcript: ENSMUST00000185919

SMART Domains

Protein: ENSMUSP00000140040
Gene: ENSMUSG00000034973

Domain	Start	End	E-Value	Type
Pfam:Dopey_N	10	306	1.9e-106	PFAM
low complexity region	629	647	N/A	INTRINSIC
low complexity region	959	971	N/A	INTRINSIC
low complexity region	1071	1082	N/A	INTRINSIC
low complexity region	1103	1116	N/A	INTRINSIC
low complexity region	1266	1279	N/A	INTRINSIC
low complexity region	1294	1316	N/A	INTRINSIC
low complexity region	1333	1342	N/A	INTRINSIC
low complexity region	1360	1371	N/A	INTRINSIC
low complexity region	1573	1587	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186290

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186418

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187607

Predicted Effect

probably benign
Transcript: ENSMUST00000188675

SMART Domains

Protein: ENSMUSP00000139413
Gene: ENSMUSG00000034973

Domain	Start	End	E-Value	Type
Pfam:Dopey_N	10	306	3e-106	PFAM
low complexity region	622	640	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190834

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190906

Predicted Effect

probably benign
Transcript: ENSMUST00000190957

SMART Domains

Protein: ENSMUSP00000140740
Gene: ENSMUSG00000034973

Domain	Start	End	E-Value	Type
Pfam:Dopey_N	10	305	1.3e-108	PFAM
low complexity region	631	649	N/A	INTRINSIC
low complexity region	961	973	N/A	INTRINSIC
low complexity region	1073	1084	N/A	INTRINSIC
low complexity region	1105	1118	N/A	INTRINSIC
low complexity region	1268	1281	N/A	INTRINSIC
low complexity region	1296	1318	N/A	INTRINSIC
low complexity region	1335	1344	N/A	INTRINSIC
low complexity region	1362	1373	N/A	INTRINSIC
low complexity region	1575	1589	N/A	INTRINSIC
low complexity region	2217	2227	N/A	INTRINSIC
low complexity region	2351	2362	N/A	INTRINSIC

Coding Region Coverage

1x: 99.5%
3x: 98.5%
10x: 96.1%
20x: 90.5%

Validation Efficiency

95% (69/73)

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931414P19Rik	C	T	14: 54,584,978		probably null	Het
Abca13	A	C	11: 9,309,034	K2920T	possibly damaging	Het
Amy2b	T	G	3: 113,149,408		noncoding transcript	Het
Anapc1	T	C	2: 128,676,249		probably null	Het
Bmp7	T	G	2: 172,916,542	D178A	probably benign	Het
Brsk1	T	A	7: 4,698,750	I170N	probably damaging	Het
Bub3	C	T	7: 131,566,335	A187V	probably benign	Het
Cacna2d2	A	G	9: 107,400,280	H71R	possibly damaging	Het
Cdrt4	A	T	11: 62,951,353	K20N	probably benign	Het
Clec12a	A	T	6: 129,353,464		probably benign	Het
Col12a1	T	A	9: 79,662,488	Y1600F	probably damaging	Het
Cyp2a12	T	A	7: 27,029,275	I57N	probably damaging	Het
Dip2b	T	C	15: 100,162,036	L223P	probably damaging	Het
Dnah5	G	A	15: 28,289,229	R1188H	probably benign	Het
Efcab5	T	A	11: 77,090,458	N1354I	probably damaging	Het
Eif4b	T	A	15: 102,086,641		probably null	Het
Elmsan1	A	T	12: 84,173,111	D356E	probably benign	Het
Erlec1	A	G	11: 30,943,697		probably null	Het
Esp24	T	C	17: 39,040,077		probably benign	Het
Esp34	T	C	17: 38,559,491	V24A	possibly damaging	Het
Fbxw15	T	A	9: 109,568,232		probably benign	Het
Foxc2	T	C	8: 121,117,452	S280P	probably damaging	Het
Gm21738	G	C	14: 19,417,178	L117V	probably benign	Het
Grk3	A	G	5: 112,920,136	F467S	probably damaging	Het
Grwd1	C	T	7: 45,827,780	G228S	probably damaging	Het
Gtf2i	T	C	5: 134,260,629	E399G	probably damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Lhx4	A	G	1: 155,710,134	Y83H	probably damaging	Het
Mdga1	T	C	17: 29,850,656	T413A	probably damaging	Het
Mmrn2	T	A	14: 34,397,616	L184H	probably damaging	Het
Mroh2a	C	T	1: 88,259,589	R133C	probably damaging	Het
Myh13	A	C	11: 67,344,881		probably null	Het
Nkain3	C	A	4: 20,282,985	R116L	possibly damaging	Het
Nxph2	A	C	2: 23,400,272	Q212P	probably damaging	Het
Olfr268-ps1	T	C	2: 111,844,345		noncoding transcript	Het
Olfr726	A	G	14: 50,084,603	F26S	probably benign	Het
Otog	T	C	7: 46,285,124	Y1369H	probably damaging	Het
Prl	A	G	13: 27,064,351	I131V	possibly damaging	Het
Ptprg	A	T	14: 12,142,467	I373F	possibly damaging	Het
Rad18	A	T	6: 112,693,529	C25S	probably damaging	Het
Rgs12	A	G	5: 35,032,311	T678A	probably damaging	Het
Scaper	T	A	9: 55,858,115	E557V	probably damaging	Het
Scube3	C	T	17: 28,164,788	P511L	probably null	Het
Sgpl1	A	G	10: 61,104,452		probably benign	Het
Slc10a1	C	A	12: 80,967,804	E47D	probably damaging	Het
Sptbn4	T	C	7: 27,418,471	N369S	probably damaging	Het
Sstr5	T	C	17: 25,491,224	T344A	probably benign	Het
Tgm4	C	T	9: 123,066,752	T631I	probably benign	Het
Tmprss15	A	G	16: 79,024,438	Y457H	probably damaging	Het
Trpm7	A	T	2: 126,848,538	W207R	probably damaging	Het
Trpm7	A	T	2: 126,795,509		probably null	Het
Ttc26	A	G	6: 38,381,557		probably benign	Het
Ugt1a1	CAGAGAGAGAGAGA	CAGAGAGAGAGA	1: 88,211,984		probably benign	Het
Ugt1a10	C	T	1: 88,215,123	P113L	probably damaging	Het
Usp2	A	T	9: 44,091,259	H384L	probably damaging	Het
Vmn2r27	C	T	6: 124,230,176	V169I	probably benign	Het
Vopp1	A	C	6: 57,762,476	F29C	probably damaging	Het
Wrn	T	C	8: 33,251,832	D953G	probably damaging	Het
Zfp759	T	A	13: 67,139,643	C419*	probably null	Het

Other mutations in Dopey1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00226:Dopey1	APN	9	86551679	missense	possibly damaging	0.57
IGL00427:Dopey1	APN	9	86521500	missense	probably benign	0.09
IGL00427:Dopey1	APN	9	86521498	missense	possibly damaging	0.93
IGL00427:Dopey1	APN	9	86521499	missense	probably damaging	0.96
IGL00577:Dopey1	APN	9	86520946	missense	probably damaging	1.00
IGL00741:Dopey1	APN	9	86522806	missense	possibly damaging	0.50
IGL00959:Dopey1	APN	9	86487431	missense	probably damaging	1.00
IGL01339:Dopey1	APN	9	86551677	missense	possibly damaging	0.90
IGL01608:Dopey1	APN	9	86507561	missense	probably benign	0.23
IGL01760:Dopey1	APN	9	86519923	missense	probably benign
IGL01788:Dopey1	APN	9	86531719	missense	probably benign	0.03
IGL01844:Dopey1	APN	9	86514085	missense	probably damaging	1.00
IGL01923:Dopey1	APN	9	86522867	missense	probably damaging	1.00
IGL02036:Dopey1	APN	9	86531765	missense	probably benign	0.18
IGL02308:Dopey1	APN	9	86520088	missense	probably damaging	0.98
IGL02494:Dopey1	APN	9	86526818	missense	probably damaging	1.00
IGL02698:Dopey1	APN	9	86524359	splice site	probably benign
IGL02731:Dopey1	APN	9	86487381	missense	probably damaging	1.00
IGL02821:Dopey1	APN	9	86520156	missense	probably benign
IGL02952:Dopey1	APN	9	86532922	splice site	probably benign
IGL03071:Dopey1	APN	9	86489615	missense	possibly damaging	0.91
IGL03271:Dopey1	APN	9	86504222	nonsense	probably null
IGL03344:Dopey1	APN	9	86536144	missense	probably damaging	1.00
Beg	UTSW	9	86548172	nonsense	probably null
covet	UTSW	9	86515343	missense	probably damaging	1.00
crave	UTSW	9	86517039	missense	probably benign
desire	UTSW	9	86520056	missense	possibly damaging	0.47
groak	UTSW	9	86521657	missense	probably damaging	1.00
Querer	UTSW	9	86504212	missense	probably damaging	1.00
yearn	UTSW	9	86504167	splice site	probably null
R0055:Dopey1	UTSW	9	86512652	missense	probably benign	0.08
R0285:Dopey1	UTSW	9	86512639	missense	probably damaging	1.00
R0415:Dopey1	UTSW	9	86506502	missense	probably damaging	1.00
R0427:Dopey1	UTSW	9	86507532	missense	probably damaging	1.00
R0514:Dopey1	UTSW	9	86520734	missense	probably damaging	1.00
R0538:Dopey1	UTSW	9	86485497	missense	probably damaging	1.00
R1118:Dopey1	UTSW	9	86515406	missense	probably damaging	1.00
R1158:Dopey1	UTSW	9	86485556	missense	probably damaging	1.00
R1272:Dopey1	UTSW	9	86521424	missense	probably damaging	1.00
R1448:Dopey1	UTSW	9	86542732	splice site	probably null
R1584:Dopey1	UTSW	9	86548172	nonsense	probably null
R1601:Dopey1	UTSW	9	86536250	missense	probably damaging	0.99
R1674:Dopey1	UTSW	9	86536160	missense	probably damaging	0.98
R1706:Dopey1	UTSW	9	86554080	missense	possibly damaging	0.92
R1856:Dopey1	UTSW	9	86492004	missense	probably damaging	0.99
R1926:Dopey1	UTSW	9	86523019	missense	probably damaging	1.00
R1929:Dopey1	UTSW	9	86494418	missense	probably damaging	1.00
R2029:Dopey1	UTSW	9	86521365	missense	probably damaging	1.00
R2125:Dopey1	UTSW	9	86521046	missense	probably damaging	1.00
R2206:Dopey1	UTSW	9	86521599	missense	probably benign	0.00
R2271:Dopey1	UTSW	9	86494418	missense	probably damaging	1.00
R2312:Dopey1	UTSW	9	86521442	nonsense	probably null
R2379:Dopey1	UTSW	9	86521085	missense	probably damaging	1.00
R2507:Dopey1	UTSW	9	86513117	missense	probably damaging	1.00
R3737:Dopey1	UTSW	9	86494433	missense	probably damaging	1.00
R3804:Dopey1	UTSW	9	86520995	missense	probably damaging	1.00
R3916:Dopey1	UTSW	9	86521133	missense	probably damaging	1.00
R3921:Dopey1	UTSW	9	86520271	missense	probably benign	0.06
R4035:Dopey1	UTSW	9	86494433	missense	probably damaging	1.00
R4404:Dopey1	UTSW	9	86522813	nonsense	probably null
R4513:Dopey1	UTSW	9	86520559	missense	probably benign	0.39
R4624:Dopey1	UTSW	9	86521525	missense	probably damaging	1.00
R4659:Dopey1	UTSW	9	86502032	intron	probably benign
R4910:Dopey1	UTSW	9	86492061	missense	probably damaging	1.00
R4919:Dopey1	UTSW	9	86520056	missense	possibly damaging	0.47
R5061:Dopey1	UTSW	9	86503108	splice site	probably benign
R5079:Dopey1	UTSW	9	86487421	missense	probably damaging	1.00
R5118:Dopey1	UTSW	9	86506259	missense	probably damaging	1.00
R5169:Dopey1	UTSW	9	86533021	missense	probably damaging	1.00
R5176:Dopey1	UTSW	9	86521815	missense	probably damaging	1.00
R5190:Dopey1	UTSW	9	86487304	missense	probably damaging	1.00
R5256:Dopey1	UTSW	9	86515328	missense	probably damaging	1.00
R5346:Dopey1	UTSW	9	86520782	missense	probably damaging	1.00
R5484:Dopey1	UTSW	9	86545288	missense	probably damaging	1.00
R5501:Dopey1	UTSW	9	86507730	missense	probably benign	0.04
R5554:Dopey1	UTSW	9	86521657	missense	probably damaging	1.00
R5707:Dopey1	UTSW	9	86502997	missense	possibly damaging	0.95
R5826:Dopey1	UTSW	9	86507570	missense	possibly damaging	0.94
R5921:Dopey1	UTSW	9	86501922	missense	probably damaging	1.00
R5934:Dopey1	UTSW	9	86542442	nonsense	probably null
R5936:Dopey1	UTSW	9	86536512	nonsense	probably null
R6046:Dopey1	UTSW	9	86515343	missense	probably damaging	1.00
R6053:Dopey1	UTSW	9	86515294	missense	possibly damaging	0.95
R6072:Dopey1	UTSW	9	86507697	missense	probably benign	0.00
R6104:Dopey1	UTSW	9	86520807	missense	possibly damaging	0.86
R6125:Dopey1	UTSW	9	86521133	missense	probably damaging	1.00
R6299:Dopey1	UTSW	9	86504212	missense	probably damaging	1.00
R6930:Dopey1	UTSW	9	86531772	critical splice donor site	probably null
R6949:Dopey1	UTSW	9	86500860	missense	probably damaging	1.00
R6979:Dopey1	UTSW	9	86521642	missense	possibly damaging	0.77
R7035:Dopey1	UTSW	9	86524302	missense	possibly damaging	0.85
R7069:Dopey1	UTSW	9	86550169	critical splice donor site	probably null
R7101:Dopey1	UTSW	9	86507669	missense	probably benign
R7202:Dopey1	UTSW	9	86504167	splice site	probably null
R7222:Dopey1	UTSW	9	86522876	critical splice donor site	probably null
R7233:Dopey1	UTSW	9	86521696	missense	probably benign	0.00
R7236:Dopey1	UTSW	9	86515378	missense	probably damaging	1.00
R7252:Dopey1	UTSW	9	86500821	missense	probably damaging	1.00
R7268:Dopey1	UTSW	9	86512777	nonsense	probably null
R7353:Dopey1	UTSW	9	86512859	missense	probably damaging	0.99
R7481:Dopey1	UTSW	9	86535932	missense	probably damaging	1.00
R7498:Dopey1	UTSW	9	86494411	missense	possibly damaging	0.95
R7507:Dopey1	UTSW	9	86535949	missense	probably benign	0.01
R7525:Dopey1	UTSW	9	86506290	missense	probably damaging	1.00
R7539:Dopey1	UTSW	9	86521573	missense	probably benign	0.03
R7751:Dopey1	UTSW	9	86507730	missense	probably benign	0.00
R7753:Dopey1	UTSW	9	86489702	missense	possibly damaging	0.52
R7839:Dopey1	UTSW	9	86542765	nonsense	probably null
R7868:Dopey1	UTSW	9	86501984	critical splice donor site	probably null
R8061:Dopey1	UTSW	9	86521193	missense	possibly damaging	0.95
R8067:Dopey1	UTSW	9	86518339	missense	probably benign	0.00
R8156:Dopey1	UTSW	9	86494457	missense	probably damaging	1.00
R8196:Dopey1	UTSW	9	86523098	missense	probably benign	0.12
R8223:Dopey1	UTSW	9	86518292	missense	probably damaging	1.00
R8267:Dopey1	UTSW	9	86514001	missense	possibly damaging	0.81
R8276:Dopey1	UTSW	9	86517039	missense	probably benign
R8306:Dopey1	UTSW	9	86520206	missense	possibly damaging	0.94
R8353:Dopey1	UTSW	9	86521586	missense	probably damaging	0.97
R8362:Dopey1	UTSW	9	86513888	missense	probably benign	0.02
R8403:Dopey1	UTSW	9	86500872	missense	probably damaging	1.00
R8817:Dopey1	UTSW	9	86513950	missense	possibly damaging	0.91
R8862:Dopey1	UTSW	9	86524351	critical splice donor site	probably null
R8888:Dopey1	UTSW	9	86521534	missense	probably benign
R8972:Dopey1	UTSW	9	86521247	missense	possibly damaging	0.50
R9001:Dopey1	UTSW	9	86554321	makesense	probably null
R9011:Dopey1	UTSW	9	86515343	missense	probably damaging	1.00
R9021:Dopey1	UTSW	9	86520437	missense	probably benign	0.35
R9039:Dopey1	UTSW	9	86500817	missense	probably damaging	0.99
R9128:Dopey1	UTSW	9	86513155	missense	probably benign
R9178:Dopey1	UTSW	9	86489743	nonsense	probably null
R9238:Dopey1	UTSW	9	86532974	missense	probably benign
R9313:Dopey1	UTSW	9	86524588	makesense	probably null
R9334:Dopey1	UTSW	9	86520974	missense	probably damaging	1.00
R9422:Dopey1	UTSW	9	86543040	missense	probably damaging	1.00
R9562:Dopey1	UTSW	9	86542758	missense	probably damaging	1.00
R9584:Dopey1	UTSW	9	86503098	missense	possibly damaging	0.59
R9677:Dopey1	UTSW	9	86543045	missense
RF004:Dopey1	UTSW	9	86554191	missense	probably benign
X0019:Dopey1	UTSW	9	86506227	missense	probably damaging	1.00
X0019:Dopey1	UTSW	9	86531750	missense	probably damaging	0.98
ZE80:Dopey1	UTSW	9	86500842	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCGTTTCAGATGGGTACAG -3'
(R):5'- GACTTTGTTGCCTAACACAGTG -3'

Sequencing Primer
(F):5'- CGTTTCAGATGGGTACAGTTAAAAAC -3'
(R):5'- TGCCTAACACAGTGTAAAACATAGG -3'

Posted On

2015-07-06