Mutagenetix > Incidental Mutation

Incidental Mutation 'R4392:Tgm4'

326421

Institutional Source

Beutler Lab

Gene Symbol

Tgm4

Ensembl Gene

ENSMUSG00000025787

Gene Name

transglutaminase 4 (prostate)

Synonyms

9530008N10Rik, Eapa1, experimental autoimmune prostatitis antigen 1

MMRRC Submission

041127-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.064) question?

Stock #

R4392 (G1)

Quality Score

169

Status

Validated

Chromosome

Chromosomal Location

123034726-123067561 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 123066752 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 631 (T631I)

Ref Sequence

ENSEMBL: ENSMUSP00000026893 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026893] [ENSMUST00000140497] [ENSMUST00000215247]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000026893
AA Change: T631I

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000026893
Gene: ENSMUSG00000025787
AA Change: T631I

Domain	Start	End	E-Value	Type
Pfam:Transglut_N	8	118	4e-26	PFAM
TGc	247	340	6.25e-42	SMART
Pfam:Transglut_C	573	670	3e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000140497

SMART Domains

Protein: ENSMUSP00000122604
Gene: ENSMUSG00000025786

Domain	Start	End	E-Value	Type
low complexity region	25	35	N/A	INTRINSIC
transmembrane domain	46	68	N/A	INTRINSIC
transmembrane domain	73	95	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214552

Predicted Effect

probably benign
Transcript: ENSMUST00000215247
AA Change: T207I

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)

Meta Mutation Damage Score

0.2010

Coding Region Coverage

1x: 99.5%
3x: 98.5%
10x: 96.1%
20x: 90.5%

Validation Efficiency

95% (69/73)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired copulatory plug formation, reduced fertilization and few litters sired. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931414P19Rik	C	T	14: 54,584,978		probably null	Het
Abca13	A	C	11: 9,309,034	K2920T	possibly damaging	Het
Amy2b	T	G	3: 113,149,408		noncoding transcript	Het
Anapc1	T	C	2: 128,676,249		probably null	Het
Bmp7	T	G	2: 172,916,542	D178A	probably benign	Het
Brsk1	T	A	7: 4,698,750	I170N	probably damaging	Het
Bub3	C	T	7: 131,566,335	A187V	probably benign	Het
Cacna2d2	A	G	9: 107,400,280	H71R	possibly damaging	Het
Cdrt4	A	T	11: 62,951,353	K20N	probably benign	Het
Clec12a	A	T	6: 129,353,464		probably benign	Het
Col12a1	T	A	9: 79,662,488	Y1600F	probably damaging	Het
Cyp2a12	T	A	7: 27,029,275	I57N	probably damaging	Het
Dip2b	T	C	15: 100,162,036	L223P	probably damaging	Het
Dnah5	G	A	15: 28,289,229	R1188H	probably benign	Het
Dopey1	T	C	9: 86,503,143		probably benign	Het
Efcab5	T	A	11: 77,090,458	N1354I	probably damaging	Het
Eif4b	T	A	15: 102,086,641		probably null	Het
Elmsan1	A	T	12: 84,173,111	D356E	probably benign	Het
Erlec1	A	G	11: 30,943,697		probably null	Het
Esp24	T	C	17: 39,040,077		probably benign	Het
Esp34	T	C	17: 38,559,491	V24A	possibly damaging	Het
Fbxw15	T	A	9: 109,568,232		probably benign	Het
Foxc2	T	C	8: 121,117,452	S280P	probably damaging	Het
Gm21738	G	C	14: 19,417,178	L117V	probably benign	Het
Grk3	A	G	5: 112,920,136	F467S	probably damaging	Het
Grwd1	C	T	7: 45,827,780	G228S	probably damaging	Het
Gtf2i	T	C	5: 134,260,629	E399G	probably damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Lhx4	A	G	1: 155,710,134	Y83H	probably damaging	Het
Mdga1	T	C	17: 29,850,656	T413A	probably damaging	Het
Mmrn2	T	A	14: 34,397,616	L184H	probably damaging	Het
Mroh2a	C	T	1: 88,259,589	R133C	probably damaging	Het
Myh13	A	C	11: 67,344,881		probably null	Het
Nkain3	C	A	4: 20,282,985	R116L	possibly damaging	Het
Nxph2	A	C	2: 23,400,272	Q212P	probably damaging	Het
Olfr268-ps1	T	C	2: 111,844,345		noncoding transcript	Het
Olfr726	A	G	14: 50,084,603	F26S	probably benign	Het
Otog	T	C	7: 46,285,124	Y1369H	probably damaging	Het
Prl	A	G	13: 27,064,351	I131V	possibly damaging	Het
Ptprg	A	T	14: 12,142,467	I373F	possibly damaging	Het
Rad18	A	T	6: 112,693,529	C25S	probably damaging	Het
Rgs12	A	G	5: 35,032,311	T678A	probably damaging	Het
Scaper	T	A	9: 55,858,115	E557V	probably damaging	Het
Scube3	C	T	17: 28,164,788	P511L	probably null	Het
Sgpl1	A	G	10: 61,104,452		probably benign	Het
Slc10a1	C	A	12: 80,967,804	E47D	probably damaging	Het
Sptbn4	T	C	7: 27,418,471	N369S	probably damaging	Het
Sstr5	T	C	17: 25,491,224	T344A	probably benign	Het
Tmprss15	A	G	16: 79,024,438	Y457H	probably damaging	Het
Trpm7	A	T	2: 126,848,538	W207R	probably damaging	Het
Trpm7	A	T	2: 126,795,509		probably null	Het
Ttc26	A	G	6: 38,381,557		probably benign	Het
Ugt1a1	CAGAGAGAGAGAGA	CAGAGAGAGAGA	1: 88,211,984		probably benign	Het
Ugt1a10	C	T	1: 88,215,123	P113L	probably damaging	Het
Usp2	A	T	9: 44,091,259	H384L	probably damaging	Het
Vmn2r27	C	T	6: 124,230,176	V169I	probably benign	Het
Vopp1	A	C	6: 57,762,476	F29C	probably damaging	Het
Wrn	T	C	8: 33,251,832	D953G	probably damaging	Het
Zfp759	T	A	13: 67,139,643	C419*	probably null	Het

Other mutations in Tgm4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00432:Tgm4	APN	9	123062382	unclassified	probably benign
IGL01402:Tgm4	APN	9	123051454	missense	possibly damaging	0.82
IGL02000:Tgm4	APN	9	123056466	missense	probably damaging	1.00
IGL02120:Tgm4	APN	9	123046529	missense	probably damaging	0.98
IGL03130:Tgm4	APN	9	123056515	missense	probably damaging	1.00
IGL03188:Tgm4	APN	9	123045036	missense	probably null	0.06
R0329:Tgm4	UTSW	9	123048557	critical splice donor site	probably null
R0480:Tgm4	UTSW	9	123062419	missense	probably benign
R0644:Tgm4	UTSW	9	123051458	missense	probably damaging	1.00
R0990:Tgm4	UTSW	9	123046511	missense	probably benign	0.02
R1604:Tgm4	UTSW	9	123045064	missense	probably benign	0.39
R1644:Tgm4	UTSW	9	123051416	missense	probably damaging	1.00
R2056:Tgm4	UTSW	9	123061770	missense	probably damaging	1.00
R2058:Tgm4	UTSW	9	123061770	missense	probably damaging	1.00
R2059:Tgm4	UTSW	9	123061770	missense	probably damaging	1.00
R2076:Tgm4	UTSW	9	123051095	missense	probably benign	0.24
R2437:Tgm4	UTSW	9	123048549	nonsense	probably null
R4407:Tgm4	UTSW	9	123056530	missense	probably damaging	1.00
R4752:Tgm4	UTSW	9	123051386	missense	probably damaging	1.00
R5288:Tgm4	UTSW	9	123056494	missense	probably damaging	1.00
R5365:Tgm4	UTSW	9	123066801	missense	probably damaging	1.00
R5386:Tgm4	UTSW	9	123056494	missense	probably damaging	1.00
R5790:Tgm4	UTSW	9	123061743	missense	probably damaging	0.98
R5890:Tgm4	UTSW	9	123061638	missense	probably damaging	1.00
R6102:Tgm4	UTSW	9	123056535	missense	probably benign
R6358:Tgm4	UTSW	9	123056518	missense	probably damaging	1.00
R6956:Tgm4	UTSW	9	123064703	missense	possibly damaging	0.93
R6966:Tgm4	UTSW	9	123051142	missense	possibly damaging	0.68
R7091:Tgm4	UTSW	9	123040460	missense	probably damaging	1.00
R7258:Tgm4	UTSW	9	123062491	missense	probably benign	0.02
R7313:Tgm4	UTSW	9	123062491	missense	probably benign	0.02
R7369:Tgm4	UTSW	9	123056684	critical splice donor site	probably null
R7802:Tgm4	UTSW	9	123051336	intron	probably benign
R8219:Tgm4	UTSW	9	123045052	missense	probably benign
R8787:Tgm4	UTSW	9	123061845	missense	probably damaging	1.00
R8936:Tgm4	UTSW	9	123040476	missense	possibly damaging	0.92
R9045:Tgm4	UTSW	9	123048551	missense	possibly damaging	0.94
R9328:Tgm4	UTSW	9	123056632	missense	possibly damaging	0.93
R9359:Tgm4	UTSW	9	123052772	missense	probably damaging	1.00
R9403:Tgm4	UTSW	9	123052772	missense	probably damaging	1.00
R9471:Tgm4	UTSW	9	123040379	missense	probably benign
R9746:Tgm4	UTSW	9	123046569	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- TTCCAGCAGGCCATCTTGTC -3'
(R):5'- ATGTTAACATGCTTAGCCAAGG -3'

Sequencing Primer
(F):5'- TCTTACAGCTGAGACAAGTGGCC -3'
(R):5'- GCTCAGAGCCAATCAGGG -3'

Posted On

2015-07-06