Mutagenetix > Incidental Mutation

Incidental Mutation 'R4392:Slc10a1'

326428

Institutional Source

Beutler Lab

Gene Symbol

Slc10a1

Ensembl Gene

ENSMUSG00000021135

Gene Name

solute carrier family 10 (sodium/bile acid cotransporter family), member 1

Synonyms

Ntcp, sodium bile acid cotransporting polypeptide

MMRRC Submission

041127-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4392 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80953183-80968705 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 80967804 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 47 (E47D)

Ref Sequence

ENSEMBL: ENSMUSP00000151510 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095572] [ENSMUST00000218162] [ENSMUST00000218342] [ENSMUST00000220266]

AlphaFold

O08705

Predicted Effect

possibly damaging
Transcript: ENSMUST00000095572
AA Change: E47D

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000093229
Gene: ENSMUSG00000021135
AA Change: E47D

Domain	Start	End	E-Value	Type
Pfam:SBF	32	217	3.3e-47	PFAM
transmembrane domain	222	244	N/A	INTRINSIC
transmembrane domain	282	304	N/A	INTRINSIC
low complexity region	323	333	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000218162
AA Change: E47D

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000218342
AA Change: E47D

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)

Predicted Effect

probably damaging
Transcript: ENSMUST00000220266
AA Change: E47D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Meta Mutation Damage Score

0.3047

Coding Region Coverage

1x: 99.5%
3x: 98.5%
10x: 96.1%
20x: 90.5%

Validation Efficiency

95% (69/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the sodium/bile acid cotransporter family, which are integral membrane glycoproteins that participate in the enterohepatic circulation of bile acids. Two homologous transporters are involved in the reabsorption of bile acids; the ileal sodium/bile acid cotransporter with an apical cell localization that absorbs bile acids from the intestinal lumen, bile duct and kidney, and the liver-specific sodium/bile acid cotransporter, represented by this protein, that is found in the basolateral membranes of hepatocytes. Bile acids are the catabolic product of cholesterol metabolism, hence this protein is important for cholesterol homeostasis. [provided by RefSeq, Oct 2011]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931414P19Rik	C	T	14: 54,584,978		probably null	Het
Abca13	A	C	11: 9,309,034	K2920T	possibly damaging	Het
Amy2b	T	G	3: 113,149,408		noncoding transcript	Het
Anapc1	T	C	2: 128,676,249		probably null	Het
Bmp7	T	G	2: 172,916,542	D178A	probably benign	Het
Brsk1	T	A	7: 4,698,750	I170N	probably damaging	Het
Bub3	C	T	7: 131,566,335	A187V	probably benign	Het
Cacna2d2	A	G	9: 107,400,280	H71R	possibly damaging	Het
Cdrt4	A	T	11: 62,951,353	K20N	probably benign	Het
Clec12a	A	T	6: 129,353,464		probably benign	Het
Col12a1	T	A	9: 79,662,488	Y1600F	probably damaging	Het
Cyp2a12	T	A	7: 27,029,275	I57N	probably damaging	Het
Dip2b	T	C	15: 100,162,036	L223P	probably damaging	Het
Dnah5	G	A	15: 28,289,229	R1188H	probably benign	Het
Dopey1	T	C	9: 86,503,143		probably benign	Het
Efcab5	T	A	11: 77,090,458	N1354I	probably damaging	Het
Eif4b	T	A	15: 102,086,641		probably null	Het
Elmsan1	A	T	12: 84,173,111	D356E	probably benign	Het
Erlec1	A	G	11: 30,943,697		probably null	Het
Esp24	T	C	17: 39,040,077		probably benign	Het
Esp34	T	C	17: 38,559,491	V24A	possibly damaging	Het
Fbxw15	T	A	9: 109,568,232		probably benign	Het
Foxc2	T	C	8: 121,117,452	S280P	probably damaging	Het
Gm21738	G	C	14: 19,417,178	L117V	probably benign	Het
Grk3	A	G	5: 112,920,136	F467S	probably damaging	Het
Grwd1	C	T	7: 45,827,780	G228S	probably damaging	Het
Gtf2i	T	C	5: 134,260,629	E399G	probably damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Lhx4	A	G	1: 155,710,134	Y83H	probably damaging	Het
Mdga1	T	C	17: 29,850,656	T413A	probably damaging	Het
Mmrn2	T	A	14: 34,397,616	L184H	probably damaging	Het
Mroh2a	C	T	1: 88,259,589	R133C	probably damaging	Het
Myh13	A	C	11: 67,344,881		probably null	Het
Nkain3	C	A	4: 20,282,985	R116L	possibly damaging	Het
Nxph2	A	C	2: 23,400,272	Q212P	probably damaging	Het
Olfr268-ps1	T	C	2: 111,844,345		noncoding transcript	Het
Olfr726	A	G	14: 50,084,603	F26S	probably benign	Het
Otog	T	C	7: 46,285,124	Y1369H	probably damaging	Het
Prl	A	G	13: 27,064,351	I131V	possibly damaging	Het
Ptprg	A	T	14: 12,142,467	I373F	possibly damaging	Het
Rad18	A	T	6: 112,693,529	C25S	probably damaging	Het
Rgs12	A	G	5: 35,032,311	T678A	probably damaging	Het
Scaper	T	A	9: 55,858,115	E557V	probably damaging	Het
Scube3	C	T	17: 28,164,788	P511L	probably null	Het
Sgpl1	A	G	10: 61,104,452		probably benign	Het
Sptbn4	T	C	7: 27,418,471	N369S	probably damaging	Het
Sstr5	T	C	17: 25,491,224	T344A	probably benign	Het
Tgm4	C	T	9: 123,066,752	T631I	probably benign	Het
Tmprss15	A	G	16: 79,024,438	Y457H	probably damaging	Het
Trpm7	A	T	2: 126,848,538	W207R	probably damaging	Het
Trpm7	A	T	2: 126,795,509		probably null	Het
Ttc26	A	G	6: 38,381,557		probably benign	Het
Ugt1a1	CAGAGAGAGAGAGA	CAGAGAGAGAGA	1: 88,211,984		probably benign	Het
Ugt1a10	C	T	1: 88,215,123	P113L	probably damaging	Het
Usp2	A	T	9: 44,091,259	H384L	probably damaging	Het
Vmn2r27	C	T	6: 124,230,176	V169I	probably benign	Het
Vopp1	A	C	6: 57,762,476	F29C	probably damaging	Het
Wrn	T	C	8: 33,251,832	D953G	probably damaging	Het
Zfp759	T	A	13: 67,139,643	C419*	probably null	Het

Other mutations in Slc10a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01870:Slc10a1	APN	12	80960528	missense	probably benign	0.00
IGL02065:Slc10a1	APN	12	80960474	missense	possibly damaging	0.94
R0212:Slc10a1	UTSW	12	80967712	missense	possibly damaging	0.62
R1170:Slc10a1	UTSW	12	80956028	missense	probably damaging	1.00
R1261:Slc10a1	UTSW	12	80967830	missense	probably damaging	1.00
R1832:Slc10a1	UTSW	12	80953672	missense	probably benign	0.23
R2010:Slc10a1	UTSW	12	80960447	missense	probably benign	0.00
R2094:Slc10a1	UTSW	12	80956048	missense	possibly damaging	0.88
R2206:Slc10a1	UTSW	12	80967628	missense	probably damaging	0.99
R3905:Slc10a1	UTSW	12	80967667	missense	probably damaging	0.99
R4413:Slc10a1	UTSW	12	80958132	missense	probably benign	0.01
R5173:Slc10a1	UTSW	12	80956028	missense	probably damaging	1.00
R5344:Slc10a1	UTSW	12	80953766	missense	possibly damaging	0.56
R7173:Slc10a1	UTSW	12	80955976	missense	probably damaging	1.00
R7253:Slc10a1	UTSW	12	80958184	missense	probably benign	0.16
R7413:Slc10a1	UTSW	12	80960622	missense	probably benign	0.00
R7990:Slc10a1	UTSW	12	80953780	missense	probably benign	0.01
R8879:Slc10a1	UTSW	12	80967595	missense	probably damaging	1.00
R9304:Slc10a1	UTSW	12	80958183	missense	probably benign	0.00
R9483:Slc10a1	UTSW	12	80956090	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCATGGCCAGGGTGAAGAG -3'
(R):5'- TTGTCCAGAAACTCTGTCCTG -3'

Sequencing Primer
(F):5'- AAGAGGTTAGACAGGTTCCCCC -3'
(R):5'- TGTCCAGAAACTCTGTCCTGAAAGAG -3'

Posted On

2015-07-06