Incidental Mutation 'R4392:Mideas'
ID 326429
Institutional Source Beutler Lab
Gene Symbol Mideas
Ensembl Gene ENSMUSG00000042507
Gene Name mitotic deacetylase associated SANT domain protein
Synonyms C130039O16Rik, Elmsan1, 9430029N19Rik
MMRRC Submission 041127-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.530) question?
Stock # R4392 (G1)
Quality Score 181
Status Validated
Chromosome 12
Chromosomal Location 84195950-84265655 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 84219885 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 356 (D356E)
Ref Sequence ENSEMBL: ENSMUSP00000152853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046266] [ENSMUST00000110294] [ENSMUST00000220974]
AlphaFold E9Q2I4
Predicted Effect probably benign
Transcript: ENSMUST00000046266
AA Change: D356E

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000048120
Gene: ENSMUSG00000042507
AA Change: D356E

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 107 117 N/A INTRINSIC
low complexity region 124 132 N/A INTRINSIC
low complexity region 247 265 N/A INTRINSIC
low complexity region 377 388 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
ELM2 715 772 6.76e-14 SMART
low complexity region 798 814 N/A INTRINSIC
SANT 821 869 1.44e-5 SMART
low complexity region 906 926 N/A INTRINSIC
low complexity region 942 956 N/A INTRINSIC
ZnF_C2H2 1030 1052 4.72e-2 SMART
low complexity region 1053 1082 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110294
AA Change: D356E

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000105923
Gene: ENSMUSG00000042507
AA Change: D356E

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 107 117 N/A INTRINSIC
low complexity region 124 132 N/A INTRINSIC
low complexity region 247 265 N/A INTRINSIC
low complexity region 377 388 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
ELM2 715 772 6.76e-14 SMART
low complexity region 798 814 N/A INTRINSIC
SANT 821 869 1.44e-5 SMART
low complexity region 906 926 N/A INTRINSIC
low complexity region 942 956 N/A INTRINSIC
ZnF_C2H2 1030 1052 4.72e-2 SMART
low complexity region 1053 1082 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220974
AA Change: D356E

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.0606 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.5%
  • 10x: 96.1%
  • 20x: 90.5%
Validation Efficiency 95% (69/73)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik C T 14: 54,822,435 (GRCm39) probably null Het
Abca13 A C 11: 9,259,034 (GRCm39) K2920T possibly damaging Het
Amy2b T G 3: 113,056,724 (GRCm39) noncoding transcript Het
Anapc1 T C 2: 128,518,169 (GRCm39) probably null Het
Bmp7 T G 2: 172,758,335 (GRCm39) D178A probably benign Het
Brsk1 T A 7: 4,701,749 (GRCm39) I170N probably damaging Het
Bub3 C T 7: 131,168,064 (GRCm39) A187V probably benign Het
Cacna2d2 A G 9: 107,277,479 (GRCm39) H71R possibly damaging Het
Cdrt4 A T 11: 62,842,179 (GRCm39) K20N probably benign Het
Clec12a A T 6: 129,330,427 (GRCm39) probably benign Het
Col12a1 T A 9: 79,569,770 (GRCm39) Y1600F probably damaging Het
Cyp2a12 T A 7: 26,728,700 (GRCm39) I57N probably damaging Het
Dip2b T C 15: 100,059,917 (GRCm39) L223P probably damaging Het
Dnah5 G A 15: 28,289,375 (GRCm39) R1188H probably benign Het
Dop1a T C 9: 86,385,196 (GRCm39) probably benign Het
Efcab5 T A 11: 76,981,284 (GRCm39) N1354I probably damaging Het
Eif4b T A 15: 101,995,076 (GRCm39) probably null Het
Erlec1 A G 11: 30,893,697 (GRCm39) probably null Het
Esp24 T C 17: 39,350,968 (GRCm39) probably benign Het
Esp34 T C 17: 38,870,382 (GRCm39) V24A possibly damaging Het
Fbxw15 T A 9: 109,397,300 (GRCm39) probably benign Het
Foxc2 T C 8: 121,844,191 (GRCm39) S280P probably damaging Het
Gm21738 G C 14: 19,417,178 (GRCm38) L117V probably benign Het
Grk3 A G 5: 113,068,002 (GRCm39) F467S probably damaging Het
Grwd1 C T 7: 45,477,204 (GRCm39) G228S probably damaging Het
Gtf2i T C 5: 134,289,483 (GRCm39) E399G probably damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Homer3 G A 8: 70,742,793 (GRCm39) probably null Het
Ift56 A G 6: 38,358,492 (GRCm39) probably benign Het
Lhx4 A G 1: 155,585,880 (GRCm39) Y83H probably damaging Het
Mdga1 T C 17: 30,069,630 (GRCm39) T413A probably damaging Het
Mmrn2 T A 14: 34,119,573 (GRCm39) L184H probably damaging Het
Mroh2a C T 1: 88,187,311 (GRCm39) R133C probably damaging Het
Myh13 A C 11: 67,235,707 (GRCm39) probably null Het
Nkain3 C A 4: 20,282,985 (GRCm39) R116L possibly damaging Het
Nxph2 A C 2: 23,290,284 (GRCm39) Q212P probably damaging Het
Or4f7d-ps1 T C 2: 111,674,690 (GRCm39) noncoding transcript Het
Or4k15c A G 14: 50,322,060 (GRCm39) F26S probably benign Het
Otog T C 7: 45,934,548 (GRCm39) Y1369H probably damaging Het
Prl A G 13: 27,248,334 (GRCm39) I131V possibly damaging Het
Ptprg A T 14: 12,142,467 (GRCm38) I373F possibly damaging Het
Rad18 A T 6: 112,670,490 (GRCm39) C25S probably damaging Het
Rgs12 A G 5: 35,189,655 (GRCm39) T678A probably damaging Het
Scaper T A 9: 55,765,399 (GRCm39) E557V probably damaging Het
Scube3 C T 17: 28,383,762 (GRCm39) P511L probably null Het
Sgpl1 A G 10: 60,940,231 (GRCm39) probably benign Het
Slc10a1 C A 12: 81,014,578 (GRCm39) E47D probably damaging Het
Sptbn4 T C 7: 27,117,896 (GRCm39) N369S probably damaging Het
Sstr5 T C 17: 25,710,198 (GRCm39) T344A probably benign Het
Tgm4 C T 9: 122,895,817 (GRCm39) T631I probably benign Het
Tmprss15 A G 16: 78,821,326 (GRCm39) Y457H probably damaging Het
Trpm7 A T 2: 126,690,458 (GRCm39) W207R probably damaging Het
Trpm7 A T 2: 126,637,429 (GRCm39) probably null Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,139,706 (GRCm39) probably benign Het
Ugt1a10 C T 1: 88,142,845 (GRCm39) P113L probably damaging Het
Usp2 A T 9: 44,002,556 (GRCm39) H384L probably damaging Het
Vmn2r27 C T 6: 124,207,135 (GRCm39) V169I probably benign Het
Vopp1 A C 6: 57,739,461 (GRCm39) F29C probably damaging Het
Wrn T C 8: 33,741,860 (GRCm39) D953G probably damaging Het
Zfp759 T A 13: 67,287,707 (GRCm39) C419* probably null Het
Other mutations in Mideas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Mideas APN 12 84,219,629 (GRCm39) nonsense probably null
IGL00913:Mideas APN 12 84,219,632 (GRCm39) missense probably benign
IGL00944:Mideas APN 12 84,207,322 (GRCm39) splice site probably benign
IGL01108:Mideas APN 12 84,220,465 (GRCm39) missense probably damaging 1.00
IGL01952:Mideas APN 12 84,220,040 (GRCm39) missense probably benign 0.00
IGL01961:Mideas APN 12 84,220,388 (GRCm39) missense probably damaging 1.00
IGL02188:Mideas APN 12 84,209,100 (GRCm39) missense probably benign 0.00
IGL02700:Mideas APN 12 84,199,636 (GRCm39) missense probably benign 0.06
R0645:Mideas UTSW 12 84,205,077 (GRCm39) missense possibly damaging 0.71
R1387:Mideas UTSW 12 84,199,705 (GRCm39) missense probably damaging 0.98
R1740:Mideas UTSW 12 84,219,676 (GRCm39) missense probably damaging 0.99
R1769:Mideas UTSW 12 84,205,124 (GRCm39) splice site probably benign
R1795:Mideas UTSW 12 84,205,748 (GRCm39) critical splice donor site probably null
R2146:Mideas UTSW 12 84,219,809 (GRCm39) missense probably damaging 0.99
R2872:Mideas UTSW 12 84,203,245 (GRCm39) missense probably benign 0.00
R2872:Mideas UTSW 12 84,203,245 (GRCm39) missense probably benign 0.00
R2940:Mideas UTSW 12 84,203,245 (GRCm39) missense probably benign 0.00
R3408:Mideas UTSW 12 84,203,245 (GRCm39) missense probably benign 0.00
R3689:Mideas UTSW 12 84,203,245 (GRCm39) missense probably benign 0.00
R3691:Mideas UTSW 12 84,203,245 (GRCm39) missense probably benign 0.00
R3840:Mideas UTSW 12 84,218,383 (GRCm39) missense probably damaging 0.99
R4364:Mideas UTSW 12 84,203,245 (GRCm39) missense probably benign 0.00
R4366:Mideas UTSW 12 84,203,245 (GRCm39) missense probably benign 0.00
R4439:Mideas UTSW 12 84,203,245 (GRCm39) missense probably benign 0.00
R4440:Mideas UTSW 12 84,203,245 (GRCm39) missense probably benign 0.00
R4496:Mideas UTSW 12 84,203,245 (GRCm39) missense probably benign 0.00
R5227:Mideas UTSW 12 84,199,661 (GRCm39) missense probably benign 0.10
R6921:Mideas UTSW 12 84,203,233 (GRCm39) missense probably damaging 0.99
R7675:Mideas UTSW 12 84,220,574 (GRCm39) missense probably damaging 1.00
R8956:Mideas UTSW 12 84,209,102 (GRCm39) missense probably benign
R8990:Mideas UTSW 12 84,218,380 (GRCm39) missense probably benign
R9058:Mideas UTSW 12 84,220,642 (GRCm39) missense probably damaging 0.98
R9106:Mideas UTSW 12 84,199,327 (GRCm39) missense probably damaging 0.99
R9205:Mideas UTSW 12 84,199,661 (GRCm39) missense probably benign 0.00
R9369:Mideas UTSW 12 84,219,670 (GRCm39) missense probably benign
R9643:Mideas UTSW 12 84,219,885 (GRCm39) missense probably benign 0.06
R9794:Mideas UTSW 12 84,220,576 (GRCm39) missense probably damaging 0.98
Z1176:Mideas UTSW 12 84,220,275 (GRCm39) missense probably damaging 0.98
Z1176:Mideas UTSW 12 84,220,273 (GRCm39) missense probably damaging 0.99
Z1177:Mideas UTSW 12 84,209,132 (GRCm39) nonsense probably null
Z1177:Mideas UTSW 12 84,199,765 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GACCTCCTCATTACCCATGG -3'
(R):5'- AACAGCACCAGGACTTTGGC -3'

Sequencing Primer
(F):5'- CGCTCCCGACCATTGGG -3'
(R):5'- AGGACTTTGGCCTGGCAC -3'
Posted On 2015-07-06