Incidental Mutation 'R4392:Elmsan1'
ID326429
Institutional Source Beutler Lab
Gene Symbol Elmsan1
Ensembl Gene ENSMUSG00000042507
Gene NameELM2 and Myb/SANT-like domain containing 1
Synonyms9430029N19Rik, C130039O16Rik
MMRRC Submission 041127-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.478) question?
Stock #R4392 (G1)
Quality Score181
Status Validated
Chromosome12
Chromosomal Location84149176-84218881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84173111 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 356 (D356E)
Ref Sequence ENSEMBL: ENSMUSP00000152853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046266] [ENSMUST00000110294] [ENSMUST00000220974]
Predicted Effect probably benign
Transcript: ENSMUST00000046266
AA Change: D356E

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000048120
Gene: ENSMUSG00000042507
AA Change: D356E

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 107 117 N/A INTRINSIC
low complexity region 124 132 N/A INTRINSIC
low complexity region 247 265 N/A INTRINSIC
low complexity region 377 388 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
ELM2 715 772 6.76e-14 SMART
low complexity region 798 814 N/A INTRINSIC
SANT 821 869 1.44e-5 SMART
low complexity region 906 926 N/A INTRINSIC
low complexity region 942 956 N/A INTRINSIC
ZnF_C2H2 1030 1052 4.72e-2 SMART
low complexity region 1053 1082 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110294
AA Change: D356E

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000105923
Gene: ENSMUSG00000042507
AA Change: D356E

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 107 117 N/A INTRINSIC
low complexity region 124 132 N/A INTRINSIC
low complexity region 247 265 N/A INTRINSIC
low complexity region 377 388 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
ELM2 715 772 6.76e-14 SMART
low complexity region 798 814 N/A INTRINSIC
SANT 821 869 1.44e-5 SMART
low complexity region 906 926 N/A INTRINSIC
low complexity region 942 956 N/A INTRINSIC
ZnF_C2H2 1030 1052 4.72e-2 SMART
low complexity region 1053 1082 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220974
AA Change: D356E

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.0606 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.5%
  • 10x: 96.1%
  • 20x: 90.5%
Validation Efficiency 95% (69/73)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik C T 14: 54,584,978 probably null Het
Abca13 A C 11: 9,309,034 K2920T possibly damaging Het
Amy2b T G 3: 113,149,408 noncoding transcript Het
Anapc1 T C 2: 128,676,249 probably null Het
Bmp7 T G 2: 172,916,542 D178A probably benign Het
Brsk1 T A 7: 4,698,750 I170N probably damaging Het
Bub3 C T 7: 131,566,335 A187V probably benign Het
Cacna2d2 A G 9: 107,400,280 H71R possibly damaging Het
Cdrt4 A T 11: 62,951,353 K20N probably benign Het
Clec12a A T 6: 129,353,464 probably benign Het
Col12a1 T A 9: 79,662,488 Y1600F probably damaging Het
Cyp2a12 T A 7: 27,029,275 I57N probably damaging Het
Dip2b T C 15: 100,162,036 L223P probably damaging Het
Dnah5 G A 15: 28,289,229 R1188H probably benign Het
Dopey1 T C 9: 86,503,143 probably benign Het
Efcab5 T A 11: 77,090,458 N1354I probably damaging Het
Eif4b T A 15: 102,086,641 probably null Het
Erlec1 A G 11: 30,943,697 probably null Het
Esp24 T C 17: 39,040,077 probably benign Het
Esp34 T C 17: 38,559,491 V24A possibly damaging Het
Fbxw15 T A 9: 109,568,232 probably benign Het
Foxc2 T C 8: 121,117,452 S280P probably damaging Het
Gm21738 G C 14: 19,417,178 L117V probably benign Het
Grk3 A G 5: 112,920,136 F467S probably damaging Het
Grwd1 C T 7: 45,827,780 G228S probably damaging Het
Gtf2i T C 5: 134,260,629 E399G probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Homer3 G A 8: 70,290,143 probably null Het
Lhx4 A G 1: 155,710,134 Y83H probably damaging Het
Mdga1 T C 17: 29,850,656 T413A probably damaging Het
Mmrn2 T A 14: 34,397,616 L184H probably damaging Het
Mroh2a C T 1: 88,259,589 R133C probably damaging Het
Myh13 A C 11: 67,344,881 probably null Het
Nkain3 C A 4: 20,282,985 R116L possibly damaging Het
Nxph2 A C 2: 23,400,272 Q212P probably damaging Het
Olfr268-ps1 T C 2: 111,844,345 noncoding transcript Het
Olfr726 A G 14: 50,084,603 F26S probably benign Het
Otog T C 7: 46,285,124 Y1369H probably damaging Het
Prl A G 13: 27,064,351 I131V possibly damaging Het
Ptprg A T 14: 12,142,467 I373F possibly damaging Het
Rad18 A T 6: 112,693,529 C25S probably damaging Het
Rgs12 A G 5: 35,032,311 T678A probably damaging Het
Scaper T A 9: 55,858,115 E557V probably damaging Het
Scube3 C T 17: 28,164,788 P511L probably null Het
Sgpl1 A G 10: 61,104,452 probably benign Het
Slc10a1 C A 12: 80,967,804 E47D probably damaging Het
Sptbn4 T C 7: 27,418,471 N369S probably damaging Het
Sstr5 T C 17: 25,491,224 T344A probably benign Het
Tgm4 C T 9: 123,066,752 T631I probably benign Het
Tmprss15 A G 16: 79,024,438 Y457H probably damaging Het
Trpm7 A T 2: 126,795,509 probably null Het
Trpm7 A T 2: 126,848,538 W207R probably damaging Het
Ttc26 A G 6: 38,381,557 probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Usp2 A T 9: 44,091,259 H384L probably damaging Het
Vmn2r27 C T 6: 124,230,176 V169I probably benign Het
Vopp1 A C 6: 57,762,476 F29C probably damaging Het
Wrn T C 8: 33,251,832 D953G probably damaging Het
Zfp759 T A 13: 67,139,643 C419* probably null Het
Other mutations in Elmsan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Elmsan1 APN 12 84172855 nonsense probably null
IGL00913:Elmsan1 APN 12 84172858 missense probably benign
IGL00944:Elmsan1 APN 12 84160548 splice site probably benign
IGL01108:Elmsan1 APN 12 84173691 missense probably damaging 1.00
IGL01952:Elmsan1 APN 12 84173266 missense probably benign 0.00
IGL01961:Elmsan1 APN 12 84173614 missense probably damaging 1.00
IGL02188:Elmsan1 APN 12 84162326 missense probably benign 0.00
IGL02700:Elmsan1 APN 12 84152862 missense probably benign 0.06
R0645:Elmsan1 UTSW 12 84158303 missense possibly damaging 0.71
R1387:Elmsan1 UTSW 12 84152931 missense probably damaging 0.98
R1740:Elmsan1 UTSW 12 84172902 missense probably damaging 0.99
R1769:Elmsan1 UTSW 12 84158350 splice site probably benign
R1795:Elmsan1 UTSW 12 84158974 critical splice donor site probably null
R2146:Elmsan1 UTSW 12 84173035 missense probably damaging 0.99
R2872:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R2872:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R2940:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R3408:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R3689:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R3691:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R3840:Elmsan1 UTSW 12 84171609 missense probably damaging 0.99
R4364:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R4366:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R4439:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R4440:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R4496:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R5227:Elmsan1 UTSW 12 84152887 missense probably benign 0.10
R6921:Elmsan1 UTSW 12 84156459 missense probably damaging 0.99
R7675:Elmsan1 UTSW 12 84173800 missense probably damaging 1.00
R8956:Elmsan1 UTSW 12 84162328 missense probably benign
R8990:Elmsan1 UTSW 12 84171606 missense probably benign
Z1176:Elmsan1 UTSW 12 84173499 missense probably damaging 0.99
Z1176:Elmsan1 UTSW 12 84173501 missense probably damaging 0.98
Z1177:Elmsan1 UTSW 12 84152991 missense probably benign 0.01
Z1177:Elmsan1 UTSW 12 84162358 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACCTCCTCATTACCCATGG -3'
(R):5'- AACAGCACCAGGACTTTGGC -3'

Sequencing Primer
(F):5'- CGCTCCCGACCATTGGG -3'
(R):5'- AGGACTTTGGCCTGGCAC -3'
Posted On2015-07-06