Incidental Mutation 'R0013:Plekhg4'
ID32643
Institutional Source Beutler Lab
Gene Symbol Plekhg4
Ensembl Gene ENSMUSG00000014782
Gene Namepleckstrin homology domain containing, family G (with RhoGef domain) member 4
Synonyms4931414L13Rik
MMRRC Submission 038308-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R0013 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location105373274-105382862 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 105375396 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 6 (E6*)
Ref Sequence ENSEMBL: ENSMUSP00000125249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014927] [ENSMUST00000159286] [ENSMUST00000160191] [ENSMUST00000160650] [ENSMUST00000214056]
Predicted Effect probably null
Transcript: ENSMUST00000014927
AA Change: E6*
SMART Domains Protein: ENSMUSP00000014927
Gene: ENSMUSG00000014782
AA Change: E6*

DomainStartEndE-ValueType
low complexity region 364 377 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
low complexity region 463 475 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
low complexity region 559 577 N/A INTRINSIC
low complexity region 653 664 N/A INTRINSIC
low complexity region 701 718 N/A INTRINSIC
RhoGEF 729 900 3.15e-29 SMART
PH 914 1022 1.44e-5 SMART
low complexity region 1148 1169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159286
SMART Domains Protein: ENSMUSP00000125556
Gene: ENSMUSG00000014782

DomainStartEndE-ValueType
SCOP:d1aua_2 136 275 5e-9 SMART
Blast:SEC14 137 271 9e-8 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000160191
AA Change: E6*
SMART Domains Protein: ENSMUSP00000125249
Gene: ENSMUSG00000014782
AA Change: E6*

DomainStartEndE-ValueType
low complexity region 295 308 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 394 406 N/A INTRINSIC
low complexity region 466 478 N/A INTRINSIC
low complexity region 490 508 N/A INTRINSIC
low complexity region 584 595 N/A INTRINSIC
low complexity region 632 649 N/A INTRINSIC
RhoGEF 660 831 3.15e-29 SMART
PH 845 953 1.44e-5 SMART
low complexity region 1079 1100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160650
Predicted Effect probably benign
Transcript: ENSMUST00000214056
Meta Mutation Damage Score 0.9706 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 94% (79/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can function as a guanine nucleotide exchange factor (GEF) and may play a role in intracellular signaling and cytoskeleton dynamics at the Golgi apparatus. Polymorphisms in the region of this gene have been found to be associated with spinocerebellar ataxia in some study populations. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A G 10: 76,457,512 M156V probably benign Het
Adnp2 A T 18: 80,129,745 V483D probably damaging Het
Aff1 G T 5: 103,828,484 E491* probably null Het
Agl A T 3: 116,776,608 C911* probably null Het
Akt2 A G 7: 27,636,058 D284G probably damaging Het
Alox15 A G 11: 70,349,635 M240T possibly damaging Het
Antxr2 A G 5: 97,979,985 V229A probably damaging Het
Arap2 G A 5: 62,683,484 L680F probably damaging Het
Btaf1 A G 19: 36,958,373 T188A probably benign Het
Btnl6 G A 17: 34,515,531 Q86* probably null Het
C2cd3 T A 7: 100,416,062 L685H probably damaging Het
Cdh23 T C 10: 60,413,173 T878A possibly damaging Het
Clec4b2 T C 6: 123,202,149 Y137H probably damaging Het
Dchs1 T A 7: 105,755,836 T2500S possibly damaging Het
Def6 A G 17: 28,217,092 Y75C probably damaging Het
Dhx33 A T 11: 70,993,635 F448L probably damaging Het
Dner C T 1: 84,494,893 probably benign Het
Dnmbp G A 19: 43,902,231 P366S probably benign Het
Eif4g3 T C 4: 138,175,848 C1160R possibly damaging Het
Elmod1 G A 9: 53,912,901 probably benign Het
Faah C A 4: 116,004,391 L305F probably damaging Het
Fam71b A G 11: 46,406,804 T312A unknown Het
Flt1 A G 5: 147,571,014 probably benign Het
Fyco1 A T 9: 123,822,406 N1196K probably benign Het
Galnt18 T C 7: 111,554,457 N320S probably damaging Het
Glp2r C A 11: 67,709,712 G437V possibly damaging Het
Gm4884 T C 7: 41,044,292 S562P probably damaging Het
Gm9936 A G 5: 114,857,347 probably benign Het
Gpn2 C A 4: 133,584,792 P112T probably damaging Het
Grm4 A G 17: 27,431,575 Y816H probably benign Het
Helz2 A T 2: 181,240,959 S14T probably benign Het
Htt T C 5: 34,820,104 L778P probably benign Het
Il11ra1 T C 4: 41,765,060 S129P probably damaging Het
Ints11 T C 4: 155,887,168 F315S probably damaging Het
Itga11 A T 9: 62,776,613 N1059Y possibly damaging Het
Jak3 A G 8: 71,684,327 S716G probably damaging Het
Kcns1 G T 2: 164,168,643 D65E probably benign Het
Kdm5d A T Y: 941,715 K1305N probably benign Het
Kif26a G T 12: 112,177,880 V1523L probably benign Het
Mboat7 A G 7: 3,683,822 S340P probably damaging Het
Mctp2 T C 7: 72,229,408 I234V probably benign Het
Mex3c G A 18: 73,590,551 A572T probably benign Het
Mpp3 C A 11: 102,005,425 R424L probably benign Het
Mroh4 T A 15: 74,608,237 probably benign Het
Myo9a A T 9: 59,860,206 probably benign Het
Myog T A 1: 134,290,235 H60Q probably damaging Het
Nlrp9a T A 7: 26,571,225 probably null Het
Notch1 A G 2: 26,473,818 V868A possibly damaging Het
Olfr352 A G 2: 36,870,160 N198S probably damaging Het
Olfr59 T A 11: 74,289,051 I135N possibly damaging Het
Olfr73 T C 2: 88,034,266 Y291C possibly damaging Het
Olfr980 A T 9: 40,006,355 I198N probably damaging Het
Pink1 T C 4: 138,317,401 T342A probably benign Het
Plb1 T A 5: 32,349,615 probably benign Het
Plec T C 15: 76,178,246 D2524G probably damaging Het
Polq T C 16: 37,061,839 F1455S possibly damaging Het
Ppm1e A G 11: 87,249,058 probably benign Het
Prkaca G A 8: 83,988,303 M119I possibly damaging Het
Prss46 G T 9: 110,850,055 S108I probably damaging Het
Ptma C T 1: 86,529,776 probably benign Het
Rab11fip4 C T 11: 79,689,653 T437M probably benign Het
Rngtt T A 4: 33,379,409 M437K probably benign Het
Rrn3 T A 16: 13,813,113 D604E possibly damaging Het
Scn4a A G 11: 106,348,405 probably benign Het
Sis A G 3: 72,910,476 L1468P possibly damaging Het
Slit3 A G 11: 35,707,918 M1450V probably benign Het
Smg5 T C 3: 88,349,233 S269P probably benign Het
Sntg1 T C 1: 8,463,462 T323A probably damaging Het
Son C T 16: 91,651,662 T37I probably damaging Het
Stk17b T C 1: 53,764,132 I41M probably benign Het
Tgm5 T A 2: 121,076,882 Y120F probably damaging Het
Tppp A G 13: 74,021,360 K73R possibly damaging Het
Ttn C A 2: 76,739,158 K27130N probably damaging Het
Ttn C T 2: 76,907,752 V4148I probably benign Het
Uba7 A T 9: 107,978,249 Y375F probably damaging Het
Ugcg T C 4: 59,213,931 L171P possibly damaging Het
Vsig2 T C 9: 37,542,576 probably benign Het
Zcchc11 T A 4: 108,530,955 probably benign Het
Zfp839 T A 12: 110,868,386 S692T possibly damaging Het
Other mutations in Plekhg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Plekhg4 APN 8 105375738 missense probably benign 0.01
IGL00970:Plekhg4 APN 8 105378435 missense probably benign 0.02
IGL01784:Plekhg4 APN 8 105378957 missense probably damaging 1.00
IGL02063:Plekhg4 APN 8 105379252 splice site probably benign
IGL02371:Plekhg4 APN 8 105379059 unclassified probably null
IGL02984:Plekhg4 UTSW 8 105380388 missense probably damaging 1.00
R0105:Plekhg4 UTSW 8 105382012 missense possibly damaging 0.65
R0105:Plekhg4 UTSW 8 105382012 missense possibly damaging 0.65
R0631:Plekhg4 UTSW 8 105379302 missense probably damaging 1.00
R1078:Plekhg4 UTSW 8 105381677 nonsense probably null
R1201:Plekhg4 UTSW 8 105381673 missense probably damaging 1.00
R1222:Plekhg4 UTSW 8 105379110 missense probably benign 0.03
R1418:Plekhg4 UTSW 8 105379110 missense probably benign 0.03
R1459:Plekhg4 UTSW 8 105381799 missense probably damaging 0.98
R1465:Plekhg4 UTSW 8 105381040 splice site probably benign
R1558:Plekhg4 UTSW 8 105381835 missense possibly damaging 0.73
R1637:Plekhg4 UTSW 8 105381781 missense probably benign 0.08
R1757:Plekhg4 UTSW 8 105381661 missense probably damaging 0.99
R1922:Plekhg4 UTSW 8 105378385 missense probably damaging 1.00
R1961:Plekhg4 UTSW 8 105381464 missense probably damaging 0.99
R2074:Plekhg4 UTSW 8 105376452 small deletion probably benign
R2113:Plekhg4 UTSW 8 105379434 missense probably damaging 1.00
R2124:Plekhg4 UTSW 8 105376452 small deletion probably benign
R2196:Plekhg4 UTSW 8 105376452 small deletion probably benign
R2321:Plekhg4 UTSW 8 105377540 missense probably benign 0.00
R2432:Plekhg4 UTSW 8 105381836 missense probably benign 0.00
R2908:Plekhg4 UTSW 8 105380861 missense probably damaging 1.00
R2910:Plekhg4 UTSW 8 105376452 small deletion probably benign
R4179:Plekhg4 UTSW 8 105381398 missense possibly damaging 0.93
R4180:Plekhg4 UTSW 8 105381398 missense possibly damaging 0.93
R4513:Plekhg4 UTSW 8 105380402 missense probably damaging 1.00
R4678:Plekhg4 UTSW 8 105380371 nonsense probably null
R4946:Plekhg4 UTSW 8 105381996 missense probably null 0.01
R5223:Plekhg4 UTSW 8 105378949 missense probably benign 0.18
R5362:Plekhg4 UTSW 8 105381398 missense possibly damaging 0.93
R5454:Plekhg4 UTSW 8 105376113 critical splice donor site probably null
R5609:Plekhg4 UTSW 8 105379502 critical splice donor site probably null
R5624:Plekhg4 UTSW 8 105380750 missense probably damaging 0.99
R5806:Plekhg4 UTSW 8 105378910 missense possibly damaging 0.85
R6297:Plekhg4 UTSW 8 105377840 missense probably damaging 1.00
R7198:Plekhg4 UTSW 8 105378697 missense probably damaging 1.00
R7443:Plekhg4 UTSW 8 105380867 missense probably damaging 1.00
R7570:Plekhg4 UTSW 8 105378684 missense possibly damaging 0.95
R7577:Plekhg4 UTSW 8 105375399 missense probably benign
R7632:Plekhg4 UTSW 8 105380150 missense probably damaging 1.00
R7782:Plekhg4 UTSW 8 105377767 missense probably benign 0.14
R7958:Plekhg4 UTSW 8 105376649 missense possibly damaging 0.86
R8239:Plekhg4 UTSW 8 105380914 nonsense probably null
R8335:Plekhg4 UTSW 8 105376216 missense probably damaging 0.97
Z1177:Plekhg4 UTSW 8 105374842 missense unknown
Predicted Primers PCR Primer
(F):5'- GCACACCAGGCTGGACTACTTTAC -3'
(R):5'- CAAGCCTTCCCCTCGATAGTCATTG -3'

Sequencing Primer
(F):5'- ACCAGGCTGGACTACTTTACTTTTAC -3'
(R):5'- CACCCTGTGTCAGGTTAAGG -3'
Posted On2013-05-09