Incidental Mutation 'R4392:Zfp759'
ID326431
Institutional Source Beutler Lab
Gene Symbol Zfp759
Ensembl Gene ENSMUSG00000057396
Gene Namezinc finger protein 759
SynonymsRslcan-8
MMRRC Submission 041127-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R4392 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location67121660-67141787 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 67139643 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 419 (C419*)
Ref Sequence ENSEMBL: ENSMUSP00000049650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052716] [ENSMUST00000224346]
Predicted Effect probably null
Transcript: ENSMUST00000052716
AA Change: C419*
SMART Domains Protein: ENSMUSP00000049650
Gene: ENSMUSG00000057396
AA Change: C419*

DomainStartEndE-ValueType
KRAB 5 65 1.6e-22 SMART
ZnF_C2H2 106 128 5.54e1 SMART
ZnF_C2H2 162 184 3.83e-2 SMART
ZnF_C2H2 190 212 1.82e-3 SMART
ZnF_C2H2 218 240 1.64e-1 SMART
ZnF_C2H2 246 268 1.67e-2 SMART
ZnF_C2H2 274 296 1.95e-3 SMART
ZnF_C2H2 302 324 1.84e-4 SMART
ZnF_C2H2 330 352 7.78e-3 SMART
ZnF_C2H2 358 380 1.6e-4 SMART
ZnF_C2H2 386 408 1.67e-2 SMART
ZnF_C2H2 414 436 4.87e-4 SMART
ZnF_C2H2 442 464 3.39e-3 SMART
ZnF_C2H2 498 520 2.57e-3 SMART
ZnF_C2H2 526 548 8.47e-4 SMART
ZnF_C2H2 554 576 2.02e-1 SMART
ZnF_C2H2 582 604 2.53e-2 SMART
ZnF_C2H2 610 632 4.79e-3 SMART
ZnF_C2H2 638 660 1.84e-4 SMART
ZnF_C2H2 666 688 1.36e-2 SMART
ZnF_C2H2 694 716 4.17e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223605
Predicted Effect probably benign
Transcript: ENSMUST00000224346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224426
Meta Mutation Damage Score 0.9716 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.5%
  • 10x: 96.1%
  • 20x: 90.5%
Validation Efficiency 95% (69/73)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik C T 14: 54,584,978 probably null Het
Abca13 A C 11: 9,309,034 K2920T possibly damaging Het
Amy2b T G 3: 113,149,408 noncoding transcript Het
Anapc1 T C 2: 128,676,249 probably null Het
Bmp7 T G 2: 172,916,542 D178A probably benign Het
Brsk1 T A 7: 4,698,750 I170N probably damaging Het
Bub3 C T 7: 131,566,335 A187V probably benign Het
Cacna2d2 A G 9: 107,400,280 H71R possibly damaging Het
Cdrt4 A T 11: 62,951,353 K20N probably benign Het
Clec12a A T 6: 129,353,464 probably benign Het
Col12a1 T A 9: 79,662,488 Y1600F probably damaging Het
Cyp2a12 T A 7: 27,029,275 I57N probably damaging Het
Dip2b T C 15: 100,162,036 L223P probably damaging Het
Dnah5 G A 15: 28,289,229 R1188H probably benign Het
Dopey1 T C 9: 86,503,143 probably benign Het
Efcab5 T A 11: 77,090,458 N1354I probably damaging Het
Eif4b T A 15: 102,086,641 probably null Het
Elmsan1 A T 12: 84,173,111 D356E probably benign Het
Erlec1 A G 11: 30,943,697 probably null Het
Esp24 T C 17: 39,040,077 probably benign Het
Esp34 T C 17: 38,559,491 V24A possibly damaging Het
Fbxw15 T A 9: 109,568,232 probably benign Het
Foxc2 T C 8: 121,117,452 S280P probably damaging Het
Gm21738 G C 14: 19,417,178 L117V probably benign Het
Grk3 A G 5: 112,920,136 F467S probably damaging Het
Grwd1 C T 7: 45,827,780 G228S probably damaging Het
Gtf2i T C 5: 134,260,629 E399G probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Homer3 G A 8: 70,290,143 probably null Het
Lhx4 A G 1: 155,710,134 Y83H probably damaging Het
Mdga1 T C 17: 29,850,656 T413A probably damaging Het
Mmrn2 T A 14: 34,397,616 L184H probably damaging Het
Mroh2a C T 1: 88,259,589 R133C probably damaging Het
Myh13 A C 11: 67,344,881 probably null Het
Nkain3 C A 4: 20,282,985 R116L possibly damaging Het
Nxph2 A C 2: 23,400,272 Q212P probably damaging Het
Olfr268-ps1 T C 2: 111,844,345 noncoding transcript Het
Olfr726 A G 14: 50,084,603 F26S probably benign Het
Otog T C 7: 46,285,124 Y1369H probably damaging Het
Prl A G 13: 27,064,351 I131V possibly damaging Het
Ptprg A T 14: 12,142,467 I373F possibly damaging Het
Rad18 A T 6: 112,693,529 C25S probably damaging Het
Rgs12 A G 5: 35,032,311 T678A probably damaging Het
Scaper T A 9: 55,858,115 E557V probably damaging Het
Scube3 C T 17: 28,164,788 P511L probably null Het
Sgpl1 A G 10: 61,104,452 probably benign Het
Slc10a1 C A 12: 80,967,804 E47D probably damaging Het
Sptbn4 T C 7: 27,418,471 N369S probably damaging Het
Sstr5 T C 17: 25,491,224 T344A probably benign Het
Tgm4 C T 9: 123,066,752 T631I probably benign Het
Tmprss15 A G 16: 79,024,438 Y457H probably damaging Het
Trpm7 A T 2: 126,795,509 probably null Het
Trpm7 A T 2: 126,848,538 W207R probably damaging Het
Ttc26 A G 6: 38,381,557 probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Usp2 A T 9: 44,091,259 H384L probably damaging Het
Vmn2r27 C T 6: 124,230,176 V169I probably benign Het
Vopp1 A C 6: 57,762,476 F29C probably damaging Het
Wrn T C 8: 33,251,832 D953G probably damaging Het
Other mutations in Zfp759
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01509:Zfp759 APN 13 67139594 missense probably benign 0.25
IGL03131:Zfp759 APN 13 67138664 missense probably damaging 1.00
IGL03218:Zfp759 APN 13 67139416 missense probably benign 0.00
R0243:Zfp759 UTSW 13 67138813 missense possibly damaging 0.66
R0319:Zfp759 UTSW 13 67140292 missense probably benign 0.00
R0520:Zfp759 UTSW 13 67137355 missense probably benign 0.29
R0961:Zfp759 UTSW 13 67139863 missense probably benign 0.32
R1435:Zfp759 UTSW 13 67138766 missense possibly damaging 0.73
R1649:Zfp759 UTSW 13 67139604 missense probably benign 0.00
R1880:Zfp759 UTSW 13 67139212 missense probably damaging 1.00
R2118:Zfp759 UTSW 13 67139514 unclassified probably benign
R2170:Zfp759 UTSW 13 67136748 missense possibly damaging 0.88
R3154:Zfp759 UTSW 13 67138655 missense probably benign 0.20
R3551:Zfp759 UTSW 13 67138967 missense probably benign 0.24
R4495:Zfp759 UTSW 13 67138925 unclassified probably null
R4736:Zfp759 UTSW 13 67139344 missense probably damaging 1.00
R4882:Zfp759 UTSW 13 67139290 missense probably damaging 1.00
R5717:Zfp759 UTSW 13 67138708 missense probably damaging 1.00
R5921:Zfp759 UTSW 13 67140494 missense probably damaging 1.00
R6247:Zfp759 UTSW 13 67140460 missense probably benign 0.00
R6381:Zfp759 UTSW 13 67138905 nonsense probably null
R6427:Zfp759 UTSW 13 67139098 unclassified probably null
R6567:Zfp759 UTSW 13 67139086 missense probably benign 0.34
R7140:Zfp759 UTSW 13 67140113 missense possibly damaging 0.92
R7731:Zfp759 UTSW 13 67139626 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CAAGGCCTTCCGTTATTCATCA -3'
(R):5'- CAGAAGGCATTTCCACACACTTTA -3'

Sequencing Primer
(F):5'- CACCATACAAGTGTAAAGTGTGTG -3'
(R):5'- TGATGGAGACCAGAAGACCTTTCTAC -3'
Posted On2015-07-06