Mutagenetix > Incidental Mutation

Incidental Mutation 'R4392:Scube3'

326440

Institutional Source

Beutler Lab

Gene Symbol

Scube3

Ensembl Gene

ENSMUSG00000038677

Gene Name

signal peptide, CUB domain, EGF-like 3

Synonyms

MMRRC Submission

041127-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.551) question?

Stock #

R4392 (G1)

Quality Score

122

Status

Validated

Chromosome

Chromosomal Location

28142316-28174852 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 28164788 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 511 (P511L)

Ref Sequence

ENSEMBL: ENSMUSP00000038366 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043503]

AlphaFold

Q66PY1

Predicted Effect

probably null
Transcript: ENSMUST00000043503
AA Change: P511L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000038366
Gene: ENSMUSG00000038677
AA Change: P511L

Domain	Start	End	E-Value	Type
low complexity region	9	15	N/A	INTRINSIC
EGF_CA	29	69	5.23e-9	SMART
EGF_CA	70	111	1.2e-8	SMART
EGF_CA	112	152	1.14e-9	SMART
EGF	160	198	6.65e-2	SMART
EGF	200	237	7.95e0	SMART
EGF	239	276	7.76e-3	SMART
EGF_CA	277	317	7.63e-11	SMART
EGF_CA	318	356	7.01e-10	SMART
EGF_CA	357	398	6.8e-8	SMART
Pfam:GCC2_GCC3	642	689	8.6e-15	PFAM
Pfam:GCC2_GCC3	696	743	4.2e-17	PFAM
Pfam:GCC2_GCC3	752	799	5.8e-17	PFAM
CUB	804	916	1.09e-16	SMART
Blast:CUB	942	988	8e-15	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000132670
AA Change: P427L

SMART Domains

Protein: ENSMUSP00000117490
Gene: ENSMUSG00000038677
AA Change: P427L

Domain	Start	End	E-Value	Type
EGF_like	1	28	1.2e-1	SMART
EGF_CA	29	69	1.14e-9	SMART
EGF	77	115	6.65e-2	SMART
EGF	117	154	7.95e0	SMART
EGF	156	193	7.76e-3	SMART
EGF_CA	194	234	7.63e-11	SMART
EGF_CA	235	273	7.01e-10	SMART
EGF_CA	274	315	6.8e-8	SMART
Pfam:GCC2_GCC3	559	606	1.8e-17	PFAM
Pfam:GCC2_GCC3	615	662	4.2e-17	PFAM
CUB	667	779	1.09e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137147

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142170

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148342

Meta Mutation Damage Score

0.1088

Coding Region Coverage

1x: 99.5%
3x: 98.5%
10x: 96.1%
20x: 90.5%

Validation Efficiency

95% (69/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the signal peptide, complement subcomponents C1r/C1s, Uegf, bone morphogenetic protein-1 and epidermal growth factor-like domain containing protein family. Overexpression of this gene in human embryonic kidney cells results in secretion of a glycosylated form of the protein that forms oligomers and tethers to the cell surface. This gene is upregulated in lung cancer tumor tissue compared to healthy tissue and is associated with loss of the epithelial marker E-cadherin and with increased expression of vimentin, a mesenchymal marker. In addition, the protein encoded by this gene is a transforming growth factor beta receptor ligand, and when secreted by cancer cells, it can be cleaved in vitro to release the N-terminal epidermal growth factor-like repeat domain and the C-terminal complement subcomponents C1r/C1s domain. Both the full length protein and C-terminal fragment can bind to the transforming growth factor beta type II receptor to promote the epithelial-mesenchymal transition and tumor angiogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a targeted allele encoding a truncated protein exhibit normal morphology. Mice with a point mutation show skeletal abnormalities, bone metabolism alterations, changes in renal function, behavioral alternations and hearing loss. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931414P19Rik	C	T	14: 54,584,978		probably null	Het
Abca13	A	C	11: 9,309,034	K2920T	possibly damaging	Het
Amy2b	T	G	3: 113,149,408		noncoding transcript	Het
Anapc1	T	C	2: 128,676,249		probably null	Het
Bmp7	T	G	2: 172,916,542	D178A	probably benign	Het
Brsk1	T	A	7: 4,698,750	I170N	probably damaging	Het
Bub3	C	T	7: 131,566,335	A187V	probably benign	Het
Cacna2d2	A	G	9: 107,400,280	H71R	possibly damaging	Het
Cdrt4	A	T	11: 62,951,353	K20N	probably benign	Het
Clec12a	A	T	6: 129,353,464		probably benign	Het
Col12a1	T	A	9: 79,662,488	Y1600F	probably damaging	Het
Cyp2a12	T	A	7: 27,029,275	I57N	probably damaging	Het
Dip2b	T	C	15: 100,162,036	L223P	probably damaging	Het
Dnah5	G	A	15: 28,289,229	R1188H	probably benign	Het
Dopey1	T	C	9: 86,503,143		probably benign	Het
Efcab5	T	A	11: 77,090,458	N1354I	probably damaging	Het
Eif4b	T	A	15: 102,086,641		probably null	Het
Elmsan1	A	T	12: 84,173,111	D356E	probably benign	Het
Erlec1	A	G	11: 30,943,697		probably null	Het
Esp24	T	C	17: 39,040,077		probably benign	Het
Esp34	T	C	17: 38,559,491	V24A	possibly damaging	Het
Fbxw15	T	A	9: 109,568,232		probably benign	Het
Foxc2	T	C	8: 121,117,452	S280P	probably damaging	Het
Gm21738	G	C	14: 19,417,178	L117V	probably benign	Het
Grk3	A	G	5: 112,920,136	F467S	probably damaging	Het
Grwd1	C	T	7: 45,827,780	G228S	probably damaging	Het
Gtf2i	T	C	5: 134,260,629	E399G	probably damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Lhx4	A	G	1: 155,710,134	Y83H	probably damaging	Het
Mdga1	T	C	17: 29,850,656	T413A	probably damaging	Het
Mmrn2	T	A	14: 34,397,616	L184H	probably damaging	Het
Mroh2a	C	T	1: 88,259,589	R133C	probably damaging	Het
Myh13	A	C	11: 67,344,881		probably null	Het
Nkain3	C	A	4: 20,282,985	R116L	possibly damaging	Het
Nxph2	A	C	2: 23,400,272	Q212P	probably damaging	Het
Olfr268-ps1	T	C	2: 111,844,345		noncoding transcript	Het
Olfr726	A	G	14: 50,084,603	F26S	probably benign	Het
Otog	T	C	7: 46,285,124	Y1369H	probably damaging	Het
Prl	A	G	13: 27,064,351	I131V	possibly damaging	Het
Ptprg	A	T	14: 12,142,467	I373F	possibly damaging	Het
Rad18	A	T	6: 112,693,529	C25S	probably damaging	Het
Rgs12	A	G	5: 35,032,311	T678A	probably damaging	Het
Scaper	T	A	9: 55,858,115	E557V	probably damaging	Het
Sgpl1	A	G	10: 61,104,452		probably benign	Het
Slc10a1	C	A	12: 80,967,804	E47D	probably damaging	Het
Sptbn4	T	C	7: 27,418,471	N369S	probably damaging	Het
Sstr5	T	C	17: 25,491,224	T344A	probably benign	Het
Tgm4	C	T	9: 123,066,752	T631I	probably benign	Het
Tmprss15	A	G	16: 79,024,438	Y457H	probably damaging	Het
Trpm7	A	T	2: 126,795,509		probably null	Het
Trpm7	A	T	2: 126,848,538	W207R	probably damaging	Het
Ttc26	A	G	6: 38,381,557		probably benign	Het
Ugt1a1	CAGAGAGAGAGAGA	CAGAGAGAGAGA	1: 88,211,984		probably benign	Het
Ugt1a10	C	T	1: 88,215,123	P113L	probably damaging	Het
Usp2	A	T	9: 44,091,259	H384L	probably damaging	Het
Vmn2r27	C	T	6: 124,230,176	V169I	probably benign	Het
Vopp1	A	C	6: 57,762,476	F29C	probably damaging	Het
Wrn	T	C	8: 33,251,832	D953G	probably damaging	Het
Zfp759	T	A	13: 67,139,643	C419*	probably null	Het

Other mutations in Scube3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02019:Scube3	APN	17	28167684	missense	probably damaging	1.00
IGL02189:Scube3	APN	17	28162996	missense	probably benign
IGL02416:Scube3	APN	17	28164136	missense	probably damaging	1.00
IGL02904:Scube3	APN	17	28167600	missense	probably benign	0.01
IGL03153:Scube3	APN	17	28167058	missense	possibly damaging	0.54
IGL03309:Scube3	APN	17	28164357	nonsense	probably null
dinklage	UTSW	17	28162388	missense	probably damaging	1.00
R0027:Scube3	UTSW	17	28164357	nonsense	probably null
R0084:Scube3	UTSW	17	28162961	missense	probably benign	0.12
R0122:Scube3	UTSW	17	28166528	splice site	probably benign
R0544:Scube3	UTSW	17	28164153	missense	probably damaging	1.00
R1779:Scube3	UTSW	17	28168379	splice site	probably benign
R1842:Scube3	UTSW	17	28165089	missense	probably damaging	1.00
R1878:Scube3	UTSW	17	28152413	missense	probably benign	0.10
R1950:Scube3	UTSW	17	28164300	missense	possibly damaging	0.66
R2011:Scube3	UTSW	17	28168158	missense	probably damaging	0.99
R2164:Scube3	UTSW	17	28166134	missense	possibly damaging	0.64
R4356:Scube3	UTSW	17	28164309	missense	probably benign	0.01
R4528:Scube3	UTSW	17	28162999	missense	possibly damaging	0.82
R4709:Scube3	UTSW	17	28167192	splice site	probably null
R4809:Scube3	UTSW	17	28165173	missense	probably damaging	1.00
R4832:Scube3	UTSW	17	28166015	missense	probably damaging	0.98
R4841:Scube3	UTSW	17	28164123	missense	probably damaging	1.00
R4842:Scube3	UTSW	17	28164123	missense	probably damaging	1.00
R5372:Scube3	UTSW	17	28152482	missense	probably damaging	0.99
R5889:Scube3	UTSW	17	28160913	missense	possibly damaging	0.84
R5936:Scube3	UTSW	17	28165487	missense	probably damaging	1.00
R6523:Scube3	UTSW	17	28162388	missense	probably damaging	1.00
R7051:Scube3	UTSW	17	28167599	missense	probably benign
R7337:Scube3	UTSW	17	28168182	missense	probably damaging	1.00
R7699:Scube3	UTSW	17	28167049	missense	probably damaging	1.00
R7700:Scube3	UTSW	17	28167049	missense	probably damaging	1.00
R7848:Scube3	UTSW	17	28165595	missense	probably benign
R7950:Scube3	UTSW	17	28171226	missense	probably benign	0.11
R8991:Scube3	UTSW	17	28164053	missense	probably damaging	0.98
R9376:Scube3	UTSW	17	28164696	missense	possibly damaging	0.92
R9469:Scube3	UTSW	17	28167164	nonsense	probably null
R9653:Scube3	UTSW	17	28156798	missense	probably damaging	1.00
R9660:Scube3	UTSW	17	28152440	missense	probably benign	0.05
RF009:Scube3	UTSW	17	28168397	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACCTTACTGCTGAGCTCGG -3'
(R):5'- TTCCACTGAAGACAAGTTCTCTC -3'

Sequencing Primer
(F):5'- TGCTGAGCTCGGAGCCAC -3'
(R):5'- ACTGAAGACAAGTTCTCTCTTCTGAC -3'

Posted On

2015-07-06