Incidental Mutation 'R4392:Scube3'
ID326440
Institutional Source Beutler Lab
Gene Symbol Scube3
Ensembl Gene ENSMUSG00000038677
Gene Namesignal peptide, CUB domain, EGF-like 3
Synonyms
MMRRC Submission 041127-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.496) question?
Stock #R4392 (G1)
Quality Score122
Status Validated
Chromosome17
Chromosomal Location28142316-28174852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 28164788 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 511 (P511L)
Ref Sequence ENSEMBL: ENSMUSP00000038366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043503]
Predicted Effect probably null
Transcript: ENSMUST00000043503
AA Change: P511L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038366
Gene: ENSMUSG00000038677
AA Change: P511L

DomainStartEndE-ValueType
low complexity region 9 15 N/A INTRINSIC
EGF_CA 29 69 5.23e-9 SMART
EGF_CA 70 111 1.2e-8 SMART
EGF_CA 112 152 1.14e-9 SMART
EGF 160 198 6.65e-2 SMART
EGF 200 237 7.95e0 SMART
EGF 239 276 7.76e-3 SMART
EGF_CA 277 317 7.63e-11 SMART
EGF_CA 318 356 7.01e-10 SMART
EGF_CA 357 398 6.8e-8 SMART
Pfam:GCC2_GCC3 642 689 8.6e-15 PFAM
Pfam:GCC2_GCC3 696 743 4.2e-17 PFAM
Pfam:GCC2_GCC3 752 799 5.8e-17 PFAM
CUB 804 916 1.09e-16 SMART
Blast:CUB 942 988 8e-15 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000132670
AA Change: P427L
SMART Domains Protein: ENSMUSP00000117490
Gene: ENSMUSG00000038677
AA Change: P427L

DomainStartEndE-ValueType
EGF_like 1 28 1.2e-1 SMART
EGF_CA 29 69 1.14e-9 SMART
EGF 77 115 6.65e-2 SMART
EGF 117 154 7.95e0 SMART
EGF 156 193 7.76e-3 SMART
EGF_CA 194 234 7.63e-11 SMART
EGF_CA 235 273 7.01e-10 SMART
EGF_CA 274 315 6.8e-8 SMART
Pfam:GCC2_GCC3 559 606 1.8e-17 PFAM
Pfam:GCC2_GCC3 615 662 4.2e-17 PFAM
CUB 667 779 1.09e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137147
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148342
Meta Mutation Damage Score 0.1088 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.5%
  • 10x: 96.1%
  • 20x: 90.5%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the signal peptide, complement subcomponents C1r/C1s, Uegf, bone morphogenetic protein-1 and epidermal growth factor-like domain containing protein family. Overexpression of this gene in human embryonic kidney cells results in secretion of a glycosylated form of the protein that forms oligomers and tethers to the cell surface. This gene is upregulated in lung cancer tumor tissue compared to healthy tissue and is associated with loss of the epithelial marker E-cadherin and with increased expression of vimentin, a mesenchymal marker. In addition, the protein encoded by this gene is a transforming growth factor beta receptor ligand, and when secreted by cancer cells, it can be cleaved in vitro to release the N-terminal epidermal growth factor-like repeat domain and the C-terminal complement subcomponents C1r/C1s domain. Both the full length protein and C-terminal fragment can bind to the transforming growth factor beta type II receptor to promote the epithelial-mesenchymal transition and tumor angiogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a targeted allele encoding a truncated protein exhibit normal morphology. Mice with a point mutation show skeletal abnormalities, bone metabolism alterations, changes in renal function, behavioral alternations and hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik C T 14: 54,584,978 probably null Het
Abca13 A C 11: 9,309,034 K2920T possibly damaging Het
Amy2b T G 3: 113,149,408 noncoding transcript Het
Anapc1 T C 2: 128,676,249 probably null Het
Bmp7 T G 2: 172,916,542 D178A probably benign Het
Brsk1 T A 7: 4,698,750 I170N probably damaging Het
Bub3 C T 7: 131,566,335 A187V probably benign Het
Cacna2d2 A G 9: 107,400,280 H71R possibly damaging Het
Cdrt4 A T 11: 62,951,353 K20N probably benign Het
Clec12a A T 6: 129,353,464 probably benign Het
Col12a1 T A 9: 79,662,488 Y1600F probably damaging Het
Cyp2a12 T A 7: 27,029,275 I57N probably damaging Het
Dip2b T C 15: 100,162,036 L223P probably damaging Het
Dnah5 G A 15: 28,289,229 R1188H probably benign Het
Dopey1 T C 9: 86,503,143 probably benign Het
Efcab5 T A 11: 77,090,458 N1354I probably damaging Het
Eif4b T A 15: 102,086,641 probably null Het
Elmsan1 A T 12: 84,173,111 D356E probably benign Het
Erlec1 A G 11: 30,943,697 probably null Het
Esp24 T C 17: 39,040,077 probably benign Het
Esp34 T C 17: 38,559,491 V24A possibly damaging Het
Fbxw15 T A 9: 109,568,232 probably benign Het
Foxc2 T C 8: 121,117,452 S280P probably damaging Het
Gm21738 G C 14: 19,417,178 L117V probably benign Het
Grk3 A G 5: 112,920,136 F467S probably damaging Het
Grwd1 C T 7: 45,827,780 G228S probably damaging Het
Gtf2i T C 5: 134,260,629 E399G probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Homer3 G A 8: 70,290,143 probably null Het
Lhx4 A G 1: 155,710,134 Y83H probably damaging Het
Mdga1 T C 17: 29,850,656 T413A probably damaging Het
Mmrn2 T A 14: 34,397,616 L184H probably damaging Het
Mroh2a C T 1: 88,259,589 R133C probably damaging Het
Myh13 A C 11: 67,344,881 probably null Het
Nkain3 C A 4: 20,282,985 R116L possibly damaging Het
Nxph2 A C 2: 23,400,272 Q212P probably damaging Het
Olfr268-ps1 T C 2: 111,844,345 noncoding transcript Het
Olfr726 A G 14: 50,084,603 F26S probably benign Het
Otog T C 7: 46,285,124 Y1369H probably damaging Het
Prl A G 13: 27,064,351 I131V possibly damaging Het
Ptprg A T 14: 12,142,467 I373F possibly damaging Het
Rad18 A T 6: 112,693,529 C25S probably damaging Het
Rgs12 A G 5: 35,032,311 T678A probably damaging Het
Scaper T A 9: 55,858,115 E557V probably damaging Het
Sgpl1 A G 10: 61,104,452 probably benign Het
Slc10a1 C A 12: 80,967,804 E47D probably damaging Het
Sptbn4 T C 7: 27,418,471 N369S probably damaging Het
Sstr5 T C 17: 25,491,224 T344A probably benign Het
Tgm4 C T 9: 123,066,752 T631I probably benign Het
Tmprss15 A G 16: 79,024,438 Y457H probably damaging Het
Trpm7 A T 2: 126,795,509 probably null Het
Trpm7 A T 2: 126,848,538 W207R probably damaging Het
Ttc26 A G 6: 38,381,557 probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Usp2 A T 9: 44,091,259 H384L probably damaging Het
Vmn2r27 C T 6: 124,230,176 V169I probably benign Het
Vopp1 A C 6: 57,762,476 F29C probably damaging Het
Wrn T C 8: 33,251,832 D953G probably damaging Het
Zfp759 T A 13: 67,139,643 C419* probably null Het
Other mutations in Scube3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02019:Scube3 APN 17 28167684 missense probably damaging 1.00
IGL02189:Scube3 APN 17 28162996 missense probably benign
IGL02416:Scube3 APN 17 28164136 missense probably damaging 1.00
IGL02904:Scube3 APN 17 28167600 missense probably benign 0.01
IGL03153:Scube3 APN 17 28167058 missense possibly damaging 0.54
IGL03309:Scube3 APN 17 28164357 nonsense probably null
dinklage UTSW 17 28162388 missense probably damaging 1.00
R0027:Scube3 UTSW 17 28164357 nonsense probably null
R0084:Scube3 UTSW 17 28162961 missense probably benign 0.12
R0122:Scube3 UTSW 17 28166528 splice site probably benign
R0544:Scube3 UTSW 17 28164153 missense probably damaging 1.00
R1779:Scube3 UTSW 17 28168379 splice site probably benign
R1842:Scube3 UTSW 17 28165089 missense probably damaging 1.00
R1878:Scube3 UTSW 17 28152413 missense probably benign 0.10
R1950:Scube3 UTSW 17 28164300 missense possibly damaging 0.66
R2011:Scube3 UTSW 17 28168158 missense probably damaging 0.99
R2164:Scube3 UTSW 17 28166134 missense possibly damaging 0.64
R4356:Scube3 UTSW 17 28164309 missense probably benign 0.01
R4528:Scube3 UTSW 17 28162999 missense possibly damaging 0.82
R4709:Scube3 UTSW 17 28167192 splice site probably null
R4809:Scube3 UTSW 17 28165173 missense probably damaging 1.00
R4832:Scube3 UTSW 17 28166015 missense probably damaging 0.98
R4841:Scube3 UTSW 17 28164123 missense probably damaging 1.00
R4842:Scube3 UTSW 17 28164123 missense probably damaging 1.00
R5372:Scube3 UTSW 17 28152482 missense probably damaging 0.99
R5889:Scube3 UTSW 17 28160913 missense possibly damaging 0.84
R5936:Scube3 UTSW 17 28165487 missense probably damaging 1.00
R6523:Scube3 UTSW 17 28162388 missense probably damaging 1.00
R7051:Scube3 UTSW 17 28167599 missense probably benign
R7337:Scube3 UTSW 17 28168182 missense probably damaging 1.00
R7699:Scube3 UTSW 17 28167049 missense probably damaging 1.00
R7700:Scube3 UTSW 17 28167049 missense probably damaging 1.00
R7848:Scube3 UTSW 17 28165595 missense probably benign
R7950:Scube3 UTSW 17 28171226 missense probably benign 0.11
RF009:Scube3 UTSW 17 28168397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCTTACTGCTGAGCTCGG -3'
(R):5'- TTCCACTGAAGACAAGTTCTCTC -3'

Sequencing Primer
(F):5'- TGCTGAGCTCGGAGCCAC -3'
(R):5'- ACTGAAGACAAGTTCTCTCTTCTGAC -3'
Posted On2015-07-06