Incidental Mutation 'R4392:Mdga1'
ID 326441
Institutional Source Beutler Lab
Gene Symbol Mdga1
Ensembl Gene ENSMUSG00000043557
Gene Name MAM domain containing glycosylphosphatidylinositol anchor 1
Synonyms Mamdc3, 1200011I03Rik
MMRRC Submission 041127-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.362) question?
Stock # R4392 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 30046930-30107557 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30069630 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 413 (T413A)
Ref Sequence ENSEMBL: ENSMUSP00000130395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073556] [ENSMUST00000165211] [ENSMUST00000167190] [ENSMUST00000171691]
AlphaFold Q0PMG2
Predicted Effect possibly damaging
Transcript: ENSMUST00000073556
AA Change: T139A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000073246
Gene: ENSMUSG00000043557
AA Change: T139A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 51 115 1.62e-12 SMART
IG 142 236 3.2e-2 SMART
IGc2 253 315 6.25e-14 SMART
IGc2 348 422 3.54e-4 SMART
IGc2 454 521 6.55e-8 SMART
IGc2 551 623 9.49e-5 SMART
FN3 642 731 2.05e0 SMART
MAM 741 911 1.02e-52 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000165211
AA Change: T139A

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132583
Gene: ENSMUSG00000043557
AA Change: T139A

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
IGc2 51 115 1.62e-12 SMART
IG_like 148 221 6.07e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167102
Predicted Effect probably damaging
Transcript: ENSMUST00000167190
AA Change: T413A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130395
Gene: ENSMUSG00000043557
AA Change: T413A

DomainStartEndE-ValueType
low complexity region 236 246 N/A INTRINSIC
low complexity region 251 265 N/A INTRINSIC
IGc2 325 389 1.62e-12 SMART
IG 416 510 3.2e-2 SMART
IGc2 527 589 6.25e-14 SMART
IGc2 622 696 3.54e-4 SMART
IGc2 728 795 6.55e-8 SMART
IGc2 825 897 9.49e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171691
AA Change: T139A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126529
Gene: ENSMUSG00000043557
AA Change: T139A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 51 115 1.62e-12 SMART
IG 142 236 3.2e-2 SMART
IGc2 253 315 6.25e-14 SMART
IGc2 348 422 3.54e-4 SMART
IGc2 454 521 6.55e-8 SMART
IGc2 551 623 9.49e-5 SMART
FN3 642 731 2.05e0 SMART
MAM 749 919 3.61e-53 SMART
Meta Mutation Damage Score 0.6134 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.5%
  • 10x: 96.1%
  • 20x: 90.5%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosylphosphatidylinositol (GPI)-anchored cell surface glycoprotein that is expressed predominantly in the developing nervous system. In addition to possessing several cell adhesion molecule-like domains, the mature protein has six Ig-like domains, a single fibronectin type III domain, a MAM domain and a C-terminal GPI-anchoring site. Studies in other mammals suggest this protein plays a role in cell adhesion, migration, and axon guidance and, in the developing brain, neuronal migration. In humans, this gene is associated with bipolar disorder and schizophrenia. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal neuronal migration during corticogenesis that is resolved by P7 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik C T 14: 54,822,435 (GRCm39) probably null Het
Abca13 A C 11: 9,259,034 (GRCm39) K2920T possibly damaging Het
Amy2b T G 3: 113,056,724 (GRCm39) noncoding transcript Het
Anapc1 T C 2: 128,518,169 (GRCm39) probably null Het
Bmp7 T G 2: 172,758,335 (GRCm39) D178A probably benign Het
Brsk1 T A 7: 4,701,749 (GRCm39) I170N probably damaging Het
Bub3 C T 7: 131,168,064 (GRCm39) A187V probably benign Het
Cacna2d2 A G 9: 107,277,479 (GRCm39) H71R possibly damaging Het
Cdrt4 A T 11: 62,842,179 (GRCm39) K20N probably benign Het
Clec12a A T 6: 129,330,427 (GRCm39) probably benign Het
Col12a1 T A 9: 79,569,770 (GRCm39) Y1600F probably damaging Het
Cyp2a12 T A 7: 26,728,700 (GRCm39) I57N probably damaging Het
Dip2b T C 15: 100,059,917 (GRCm39) L223P probably damaging Het
Dnah5 G A 15: 28,289,375 (GRCm39) R1188H probably benign Het
Dop1a T C 9: 86,385,196 (GRCm39) probably benign Het
Efcab5 T A 11: 76,981,284 (GRCm39) N1354I probably damaging Het
Eif4b T A 15: 101,995,076 (GRCm39) probably null Het
Erlec1 A G 11: 30,893,697 (GRCm39) probably null Het
Esp24 T C 17: 39,350,968 (GRCm39) probably benign Het
Esp34 T C 17: 38,870,382 (GRCm39) V24A possibly damaging Het
Fbxw15 T A 9: 109,397,300 (GRCm39) probably benign Het
Foxc2 T C 8: 121,844,191 (GRCm39) S280P probably damaging Het
Gm21738 G C 14: 19,417,178 (GRCm38) L117V probably benign Het
Grk3 A G 5: 113,068,002 (GRCm39) F467S probably damaging Het
Grwd1 C T 7: 45,477,204 (GRCm39) G228S probably damaging Het
Gtf2i T C 5: 134,289,483 (GRCm39) E399G probably damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Homer3 G A 8: 70,742,793 (GRCm39) probably null Het
Ift56 A G 6: 38,358,492 (GRCm39) probably benign Het
Lhx4 A G 1: 155,585,880 (GRCm39) Y83H probably damaging Het
Mideas A T 12: 84,219,885 (GRCm39) D356E probably benign Het
Mmrn2 T A 14: 34,119,573 (GRCm39) L184H probably damaging Het
Mroh2a C T 1: 88,187,311 (GRCm39) R133C probably damaging Het
Myh13 A C 11: 67,235,707 (GRCm39) probably null Het
Nkain3 C A 4: 20,282,985 (GRCm39) R116L possibly damaging Het
Nxph2 A C 2: 23,290,284 (GRCm39) Q212P probably damaging Het
Or4f7d-ps1 T C 2: 111,674,690 (GRCm39) noncoding transcript Het
Or4k15c A G 14: 50,322,060 (GRCm39) F26S probably benign Het
Otog T C 7: 45,934,548 (GRCm39) Y1369H probably damaging Het
Prl A G 13: 27,248,334 (GRCm39) I131V possibly damaging Het
Ptprg A T 14: 12,142,467 (GRCm38) I373F possibly damaging Het
Rad18 A T 6: 112,670,490 (GRCm39) C25S probably damaging Het
Rgs12 A G 5: 35,189,655 (GRCm39) T678A probably damaging Het
Scaper T A 9: 55,765,399 (GRCm39) E557V probably damaging Het
Scube3 C T 17: 28,383,762 (GRCm39) P511L probably null Het
Sgpl1 A G 10: 60,940,231 (GRCm39) probably benign Het
Slc10a1 C A 12: 81,014,578 (GRCm39) E47D probably damaging Het
Sptbn4 T C 7: 27,117,896 (GRCm39) N369S probably damaging Het
Sstr5 T C 17: 25,710,198 (GRCm39) T344A probably benign Het
Tgm4 C T 9: 122,895,817 (GRCm39) T631I probably benign Het
Tmprss15 A G 16: 78,821,326 (GRCm39) Y457H probably damaging Het
Trpm7 A T 2: 126,637,429 (GRCm39) probably null Het
Trpm7 A T 2: 126,690,458 (GRCm39) W207R probably damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,139,706 (GRCm39) probably benign Het
Ugt1a10 C T 1: 88,142,845 (GRCm39) P113L probably damaging Het
Usp2 A T 9: 44,002,556 (GRCm39) H384L probably damaging Het
Vmn2r27 C T 6: 124,207,135 (GRCm39) V169I probably benign Het
Vopp1 A C 6: 57,739,461 (GRCm39) F29C probably damaging Het
Wrn T C 8: 33,741,860 (GRCm39) D953G probably damaging Het
Zfp759 T A 13: 67,287,707 (GRCm39) C419* probably null Het
Other mutations in Mdga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01576:Mdga1 APN 17 30,062,101 (GRCm39) missense possibly damaging 0.50
IGL01637:Mdga1 APN 17 30,058,845 (GRCm39) missense probably damaging 1.00
IGL02130:Mdga1 APN 17 30,076,643 (GRCm39) missense possibly damaging 0.96
IGL02596:Mdga1 APN 17 30,051,379 (GRCm39) splice site probably benign
IGL03258:Mdga1 APN 17 30,058,887 (GRCm39) missense probably damaging 1.00
R0184:Mdga1 UTSW 17 30,071,416 (GRCm39) missense probably damaging 1.00
R0366:Mdga1 UTSW 17 30,076,682 (GRCm39) missense possibly damaging 0.85
R1017:Mdga1 UTSW 17 30,069,522 (GRCm39) missense probably damaging 0.98
R1520:Mdga1 UTSW 17 30,065,493 (GRCm39) missense probably benign 0.12
R1545:Mdga1 UTSW 17 30,061,876 (GRCm39) missense probably damaging 1.00
R1549:Mdga1 UTSW 17 30,056,972 (GRCm39) missense probably damaging 1.00
R1671:Mdga1 UTSW 17 30,069,603 (GRCm39) missense probably damaging 1.00
R1875:Mdga1 UTSW 17 30,071,581 (GRCm39) missense probably damaging 1.00
R1893:Mdga1 UTSW 17 30,068,200 (GRCm39) missense probably damaging 1.00
R1958:Mdga1 UTSW 17 30,059,862 (GRCm39) missense probably damaging 1.00
R1983:Mdga1 UTSW 17 30,069,579 (GRCm39) missense probably damaging 1.00
R2014:Mdga1 UTSW 17 30,068,287 (GRCm39) missense probably damaging 1.00
R2894:Mdga1 UTSW 17 30,071,478 (GRCm39) missense probably damaging 1.00
R2964:Mdga1 UTSW 17 30,071,442 (GRCm39) missense probably damaging 1.00
R3813:Mdga1 UTSW 17 30,057,453 (GRCm39) missense probably damaging 1.00
R3938:Mdga1 UTSW 17 30,076,596 (GRCm39) missense probably damaging 1.00
R3982:Mdga1 UTSW 17 30,150,238 (GRCm39) missense unknown
R4063:Mdga1 UTSW 17 30,057,005 (GRCm39) missense probably damaging 1.00
R4157:Mdga1 UTSW 17 30,052,317 (GRCm39) missense probably benign 0.32
R4183:Mdga1 UTSW 17 30,188,964 (GRCm39) missense unknown
R4393:Mdga1 UTSW 17 30,069,491 (GRCm39) missense probably damaging 1.00
R4396:Mdga1 UTSW 17 30,069,491 (GRCm39) missense probably damaging 1.00
R4806:Mdga1 UTSW 17 30,061,128 (GRCm39) missense probably benign 0.20
R4829:Mdga1 UTSW 17 30,065,343 (GRCm39) missense possibly damaging 0.91
R4923:Mdga1 UTSW 17 30,057,052 (GRCm39) missense probably damaging 0.99
R4932:Mdga1 UTSW 17 30,076,580 (GRCm39) missense probably damaging 1.00
R5015:Mdga1 UTSW 17 30,058,847 (GRCm39) missense possibly damaging 0.71
R5076:Mdga1 UTSW 17 30,069,528 (GRCm39) missense possibly damaging 0.93
R5141:Mdga1 UTSW 17 30,071,467 (GRCm39) missense probably benign 0.43
R5180:Mdga1 UTSW 17 30,076,710 (GRCm39) splice site probably benign
R5590:Mdga1 UTSW 17 30,058,841 (GRCm39) missense probably damaging 1.00
R5747:Mdga1 UTSW 17 30,069,525 (GRCm39) missense probably benign 0.11
R5748:Mdga1 UTSW 17 30,069,525 (GRCm39) missense probably benign 0.11
R6207:Mdga1 UTSW 17 30,057,491 (GRCm39) missense probably damaging 1.00
R6826:Mdga1 UTSW 17 30,189,000 (GRCm39) missense unknown
R6831:Mdga1 UTSW 17 30,106,490 (GRCm39) nonsense probably null
R7114:Mdga1 UTSW 17 30,061,816 (GRCm39) splice site probably null
R7147:Mdga1 UTSW 17 30,065,495 (GRCm39) nonsense probably null
R7273:Mdga1 UTSW 17 30,188,912 (GRCm39) missense unknown
R7413:Mdga1 UTSW 17 30,069,647 (GRCm39) missense probably damaging 1.00
R7637:Mdga1 UTSW 17 30,051,353 (GRCm39) missense probably benign 0.00
R7797:Mdga1 UTSW 17 30,061,814 (GRCm39) splice site probably null
R7812:Mdga1 UTSW 17 30,062,115 (GRCm39) missense probably benign 0.02
R7838:Mdga1 UTSW 17 30,058,796 (GRCm39) missense probably benign 0.10
R8463:Mdga1 UTSW 17 30,068,703 (GRCm39) missense probably damaging 1.00
R8697:Mdga1 UTSW 17 30,065,615 (GRCm39) missense probably damaging 0.97
R8699:Mdga1 UTSW 17 30,061,348 (GRCm39) missense possibly damaging 0.87
R8864:Mdga1 UTSW 17 30,150,295 (GRCm39) missense unknown
R8945:Mdga1 UTSW 17 30,058,959 (GRCm39) splice site probably benign
R9150:Mdga1 UTSW 17 30,057,420 (GRCm39) missense probably damaging 0.98
R9157:Mdga1 UTSW 17 30,057,491 (GRCm39) missense probably damaging 1.00
R9294:Mdga1 UTSW 17 30,058,871 (GRCm39) missense probably damaging 1.00
R9301:Mdga1 UTSW 17 30,069,512 (GRCm39) missense probably benign 0.31
R9367:Mdga1 UTSW 17 30,051,282 (GRCm39) makesense probably null
R9567:Mdga1 UTSW 17 30,076,569 (GRCm39) missense probably damaging 1.00
R9665:Mdga1 UTSW 17 30,051,991 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCCTGACCTGAGTATAGAGAG -3'
(R):5'- TGATAGGGAGCCTGGAAGTC -3'

Sequencing Primer
(F):5'- AGAGGCTCGTAGATGTCAACCC -3'
(R):5'- CTGGAAGTCATCGGATCCAGTTC -3'
Posted On 2015-07-06