Incidental Mutation 'R4393:Vwa3b'
ID326443
Institutional Source Beutler Lab
Gene Symbol Vwa3b
Ensembl Gene ENSMUSG00000050122
Gene Namevon Willebrand factor A domain containing 3B
Synonyms4921511C04Rik, A230074B11Rik
MMRRC Submission 041128-MU
Accession Numbers

NCBI RefSeq: XM_003084438.1; MGI:1918103

Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R4393 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location37026596-37187613 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37045178 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 144 (V144A)
Ref Sequence ENSEMBL: ENSMUSP00000027289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027289] [ENSMUST00000067178] [ENSMUST00000117172] [ENSMUST00000124404] [ENSMUST00000162449]
AlphaFold A0A571BE33
Predicted Effect probably damaging
Transcript: ENSMUST00000027289
AA Change: V144A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027289
Gene: ENSMUSG00000050122
AA Change: V144A

DomainStartEndE-ValueType
Pfam:DUF4537 159 285 9.1e-36 PFAM
low complexity region 327 336 N/A INTRINSIC
low complexity region 345 364 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000067178
AA Change: V144A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069700
Gene: ENSMUSG00000050122
AA Change: V144A

DomainStartEndE-ValueType
Blast:VWA 112 272 7e-16 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000117172
AA Change: V144A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114022
Gene: ENSMUSG00000050122
AA Change: V144A

DomainStartEndE-ValueType
Blast:VWA 112 272 7e-16 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000124404
AA Change: V144A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141690
Gene: ENSMUSG00000050122
AA Change: V144A

DomainStartEndE-ValueType
Blast:VWA 112 272 5e-16 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000162449
AA Change: V144A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125460
Gene: ENSMUSG00000050122
AA Change: V144A

DomainStartEndE-ValueType
Blast:VWA 112 272 7e-16 BLAST
Meta Mutation Damage Score 0.4910 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.5%
  • 20x: 92.4%
Validation Efficiency 95% (71/75)
Allele List at MGI

All alleles(71) : Targeted(3) Gene trapped(68)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433N12Rik C A 9: 3,134,944 noncoding transcript Het
Adgrg4 T G X: 56,932,343 L2193V probably damaging Het
Adgrl1 T C 8: 83,938,593 V1353A probably benign Het
Casc1 T C 6: 145,194,578 T166A possibly damaging Het
Cep68 A T 11: 20,238,544 N620K probably benign Het
Clcnkb A G 4: 141,412,236 S152P probably benign Het
Crybg3 A G 16: 59,560,095 probably benign Het
Cyp26c1 G A 19: 37,686,657 R142H probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dlg5 T A 14: 24,177,989 probably null Het
Ebf3 C T 7: 137,225,157 R342H probably damaging Het
Ece2 T C 16: 20,632,848 V380A probably damaging Het
Epb41l4a C T 18: 33,891,420 probably null Het
Erbb3 G T 10: 128,572,770 Q815K probably damaging Het
Ercc3 T A 18: 32,265,621 M651K probably benign Het
Fam3b C A 16: 97,481,786 probably null Het
Foxp2 A C 6: 15,377,690 probably benign Het
Gdf10 T C 14: 33,932,738 Y401H probably damaging Het
Gm21738 G C 14: 19,417,178 L117V probably benign Het
Gm6408 A T 5: 146,482,337 D54V probably damaging Het
Gm8909 C A 17: 36,161,969 probably benign Het
Hcn4 A G 9: 58,844,300 E403G unknown Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hjurp A G 1: 88,266,561 probably benign Het
Hyou1 T A 9: 44,381,872 V125E probably damaging Het
Il11ra1 T C 4: 41,768,577 probably null Het
Immt T A 6: 71,872,800 S435T probably benign Het
Kcnip2 A G 19: 45,812,230 L19P probably benign Het
Kctd2 T C 11: 115,429,500 probably benign Het
Mdga1 T C 17: 29,850,517 D185G probably damaging Het
Mdn1 C T 4: 32,754,482 T4666M possibly damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Msl2 A G 9: 101,101,477 E350G probably damaging Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Myo3a A T 2: 22,577,854 K373N probably damaging Het
Nr5a1 T C 2: 38,694,219 E396G probably damaging Het
Ogdh G A 11: 6,316,772 G141D probably damaging Het
Olfr1133 A T 2: 87,645,912 C70* probably null Het
Olfr1491 T C 19: 13,705,190 I121T possibly damaging Het
Olfr92 T C 17: 37,114,084 probably benign Het
Orc2 C A 1: 58,467,650 probably null Het
P4ha3 C T 7: 100,305,607 P291S probably benign Het
Pign T C 1: 105,522,026 K925R probably benign Het
Plekhm1 A G 11: 103,376,965 S727P possibly damaging Het
Prr36 G T 8: 4,214,901 probably benign Het
Prrt3 A G 6: 113,494,946 L755P probably benign Het
Secisbp2 A G 13: 51,654,466 H89R probably damaging Het
Sgms2 A T 3: 131,341,817 probably null Het
Slc35d3 T C 10: 19,849,606 probably null Het
Slu7 T A 11: 43,439,269 N174K possibly damaging Het
Teddm1a G T 1: 153,892,446 D219Y probably damaging Het
Tgtp1 C A 11: 48,987,623 G85V probably damaging Het
Tmem51 T C 4: 142,031,931 T169A probably benign Het
Tmem69 C T 4: 116,554,767 probably null Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zdhhc21 A G 4: 82,847,654 C15R possibly damaging Het
Zfp142 T C 1: 74,572,060 T756A probably benign Het
Zfp606 C T 7: 12,492,849 S241F probably damaging Het
Zfp804a A T 2: 82,256,921 T365S probably benign Het
Other mutations in Vwa3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01404:Vwa3b APN 1 37154036 missense probably benign 0.28
IGL02236:Vwa3b APN 1 37154051 splice site probably benign
IGL02653:Vwa3b APN 1 37175565 utr 3 prime probably benign
IGL02823:Vwa3b APN 1 37186904 utr 3 prime probably benign
IGL03030:Vwa3b APN 1 37044968 missense probably damaging 1.00
P0014:Vwa3b UTSW 1 37173914 utr 3 prime probably benign
R0035:Vwa3b UTSW 1 37165689 missense possibly damaging 0.69
R0102:Vwa3b UTSW 1 37135514 missense probably damaging 1.00
R0556:Vwa3b UTSW 1 37164485 splice site probably benign
R1061:Vwa3b UTSW 1 37157430 missense probably damaging 1.00
R1386:Vwa3b UTSW 1 37051881 critical splice donor site probably null
R2441:Vwa3b UTSW 1 37143069 unclassified probably benign
R3117:Vwa3b UTSW 1 37109077 missense possibly damaging 0.95
R3119:Vwa3b UTSW 1 37109077 missense possibly damaging 0.95
R4081:Vwa3b UTSW 1 37035824 missense probably damaging 0.99
R4897:Vwa3b UTSW 1 37114603 splice site probably benign
R4950:Vwa3b UTSW 1 37085332 missense probably benign 0.00
R4978:Vwa3b UTSW 1 37115671 missense probably damaging 0.99
R5141:Vwa3b UTSW 1 37187021 utr 3 prime probably benign
R5286:Vwa3b UTSW 1 37045039 missense probably damaging 1.00
R5356:Vwa3b UTSW 1 37114583 missense probably damaging 0.99
R5426:Vwa3b UTSW 1 37115671 missense probably damaging 0.99
R5480:Vwa3b UTSW 1 37100706 nonsense probably null
R5727:Vwa3b UTSW 1 37135519 missense probably benign 0.10
R5876:Vwa3b UTSW 1 37076439 missense probably damaging 0.97
R6191:Vwa3b UTSW 1 37114531 missense possibly damaging 0.92
R6219:Vwa3b UTSW 1 37100698 missense possibly damaging 0.92
R6250:Vwa3b UTSW 1 37051885 splice site probably null
R6281:Vwa3b UTSW 1 37123982 missense probably damaging 1.00
R6419:Vwa3b UTSW 1 37157376 missense probably benign 0.01
R6467:Vwa3b UTSW 1 37085286 missense probably benign 0.01
R6512:Vwa3b UTSW 1 37063642 intron probably benign
R6541:Vwa3b UTSW 1 37051761 missense probably damaging 1.00
R6724:Vwa3b UTSW 1 37045031 missense probably damaging 1.00
R6728:Vwa3b UTSW 1 37157372 missense probably damaging 1.00
R7046:Vwa3b UTSW 1 37173878 missense probably benign
R7117:Vwa3b UTSW 1 37135553 missense
R7304:Vwa3b UTSW 1 37164505 missense probably damaging 1.00
R7402:Vwa3b UTSW 1 37114597 nonsense probably null
R7762:Vwa3b UTSW 1 37124045 missense probably damaging 1.00
R7911:Vwa3b UTSW 1 37154026 missense probably damaging 1.00
R8213:Vwa3b UTSW 1 37128939 missense probably benign 0.07
R8402:Vwa3b UTSW 1 37165798 missense probably damaging 1.00
R8697:Vwa3b UTSW 1 37076380 missense probably benign 0.09
R8758:Vwa3b UTSW 1 37137792 missense
R8874:Vwa3b UTSW 1 37035758 missense possibly damaging 0.73
R9011:Vwa3b UTSW 1 37115686 missense probably damaging 1.00
R9012:Vwa3b UTSW 1 37085310 missense probably benign 0.15
R9015:Vwa3b UTSW 1 37164516 missense possibly damaging 0.71
R9102:Vwa3b UTSW 1 37135512 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- GTGGATTACTTAACACAAGCCG -3'
(R):5'- AACCTGAGGTGTCCTGAGAAG -3'

Sequencing Primer
(F):5'- CACAAGCCGTGGAGAGCTAC -3'
(R):5'- CCTGAGAAGTGCATATAAAAGTTCCC -3'
Posted On2015-07-06