Incidental Mutation 'R0013:Olfr980'
ID32645
Institutional Source Beutler Lab
Gene Symbol Olfr980
Ensembl Gene ENSMUSG00000060254
Gene Nameolfactory receptor 980
SynonymsMOR223-2, GA_x6K02T2PVTD-33705428-33704496
MMRRC Submission 038308-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R0013 (G1)
Quality Score206
Status Validated
Chromosome9
Chromosomal Location40004348-40009582 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40006355 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 198 (I198N)
Ref Sequence ENSEMBL: ENSMUSP00000150496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073932] [ENSMUST00000215523] [ENSMUST00000216463]
Predicted Effect probably damaging
Transcript: ENSMUST00000073932
AA Change: I198N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091386
Gene: ENSMUSG00000060254
AA Change: I198N

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 1.4e-55 PFAM
Pfam:7tm_1 39 287 5.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215523
Predicted Effect probably damaging
Transcript: ENSMUST00000216463
AA Change: I198N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.2716 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 94% (79/84)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A G 10: 76,457,512 M156V probably benign Het
Adnp2 A T 18: 80,129,745 V483D probably damaging Het
Aff1 G T 5: 103,828,484 E491* probably null Het
Agl A T 3: 116,776,608 C911* probably null Het
Akt2 A G 7: 27,636,058 D284G probably damaging Het
Alox15 A G 11: 70,349,635 M240T possibly damaging Het
Antxr2 A G 5: 97,979,985 V229A probably damaging Het
Arap2 G A 5: 62,683,484 L680F probably damaging Het
Btaf1 A G 19: 36,958,373 T188A probably benign Het
Btnl6 G A 17: 34,515,531 Q86* probably null Het
C2cd3 T A 7: 100,416,062 L685H probably damaging Het
Cdh23 T C 10: 60,413,173 T878A possibly damaging Het
Clec4b2 T C 6: 123,202,149 Y137H probably damaging Het
Dchs1 T A 7: 105,755,836 T2500S possibly damaging Het
Def6 A G 17: 28,217,092 Y75C probably damaging Het
Dhx33 A T 11: 70,993,635 F448L probably damaging Het
Dner C T 1: 84,494,893 probably benign Het
Dnmbp G A 19: 43,902,231 P366S probably benign Het
Eif4g3 T C 4: 138,175,848 C1160R possibly damaging Het
Elmod1 G A 9: 53,912,901 probably benign Het
Faah C A 4: 116,004,391 L305F probably damaging Het
Fam71b A G 11: 46,406,804 T312A unknown Het
Flt1 A G 5: 147,571,014 probably benign Het
Fyco1 A T 9: 123,822,406 N1196K probably benign Het
Galnt18 T C 7: 111,554,457 N320S probably damaging Het
Glp2r C A 11: 67,709,712 G437V possibly damaging Het
Gm4884 T C 7: 41,044,292 S562P probably damaging Het
Gm9936 A G 5: 114,857,347 probably benign Het
Gpn2 C A 4: 133,584,792 P112T probably damaging Het
Grm4 A G 17: 27,431,575 Y816H probably benign Het
Helz2 A T 2: 181,240,959 S14T probably benign Het
Htt T C 5: 34,820,104 L778P probably benign Het
Il11ra1 T C 4: 41,765,060 S129P probably damaging Het
Ints11 T C 4: 155,887,168 F315S probably damaging Het
Itga11 A T 9: 62,776,613 N1059Y possibly damaging Het
Jak3 A G 8: 71,684,327 S716G probably damaging Het
Kcns1 G T 2: 164,168,643 D65E probably benign Het
Kdm5d A T Y: 941,715 K1305N probably benign Het
Kif26a G T 12: 112,177,880 V1523L probably benign Het
Mboat7 A G 7: 3,683,822 S340P probably damaging Het
Mctp2 T C 7: 72,229,408 I234V probably benign Het
Mex3c G A 18: 73,590,551 A572T probably benign Het
Mpp3 C A 11: 102,005,425 R424L probably benign Het
Mroh4 T A 15: 74,608,237 probably benign Het
Myo9a A T 9: 59,860,206 probably benign Het
Myog T A 1: 134,290,235 H60Q probably damaging Het
Nlrp9a T A 7: 26,571,225 probably null Het
Notch1 A G 2: 26,473,818 V868A possibly damaging Het
Olfr352 A G 2: 36,870,160 N198S probably damaging Het
Olfr59 T A 11: 74,289,051 I135N possibly damaging Het
Olfr73 T C 2: 88,034,266 Y291C possibly damaging Het
Pink1 T C 4: 138,317,401 T342A probably benign Het
Plb1 T A 5: 32,349,615 probably benign Het
Plec T C 15: 76,178,246 D2524G probably damaging Het
Plekhg4 G T 8: 105,375,396 E6* probably null Het
Polq T C 16: 37,061,839 F1455S possibly damaging Het
Ppm1e A G 11: 87,249,058 probably benign Het
Prkaca G A 8: 83,988,303 M119I possibly damaging Het
Prss46 G T 9: 110,850,055 S108I probably damaging Het
Ptma C T 1: 86,529,776 probably benign Het
Rab11fip4 C T 11: 79,689,653 T437M probably benign Het
Rngtt T A 4: 33,379,409 M437K probably benign Het
Rrn3 T A 16: 13,813,113 D604E possibly damaging Het
Scn4a A G 11: 106,348,405 probably benign Het
Sis A G 3: 72,910,476 L1468P possibly damaging Het
Slit3 A G 11: 35,707,918 M1450V probably benign Het
Smg5 T C 3: 88,349,233 S269P probably benign Het
Sntg1 T C 1: 8,463,462 T323A probably damaging Het
Son C T 16: 91,651,662 T37I probably damaging Het
Stk17b T C 1: 53,764,132 I41M probably benign Het
Tgm5 T A 2: 121,076,882 Y120F probably damaging Het
Tppp A G 13: 74,021,360 K73R possibly damaging Het
Ttn C A 2: 76,739,158 K27130N probably damaging Het
Ttn C T 2: 76,907,752 V4148I probably benign Het
Uba7 A T 9: 107,978,249 Y375F probably damaging Het
Ugcg T C 4: 59,213,931 L171P possibly damaging Het
Vsig2 T C 9: 37,542,576 probably benign Het
Zcchc11 T A 4: 108,530,955 probably benign Het
Zfp839 T A 12: 110,868,386 S692T possibly damaging Het
Other mutations in Olfr980
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02256:Olfr980 APN 9 40006053 missense probably benign
IGL02378:Olfr980 APN 9 40006473 missense probably damaging 1.00
IGL03384:Olfr980 APN 9 40006470 missense probably benign
IGL03402:Olfr980 APN 9 40006506 missense probably benign 0.31
BB010:Olfr980 UTSW 9 40007135 start gained probably benign
PIT4651001:Olfr980 UTSW 9 40006230 missense probably damaging 0.97
R1146:Olfr980 UTSW 9 40006094 missense possibly damaging 0.95
R1146:Olfr980 UTSW 9 40006094 missense possibly damaging 0.95
R4541:Olfr980 UTSW 9 40006293 missense possibly damaging 0.95
R4562:Olfr980 UTSW 9 40006281 missense probably damaging 0.99
R4731:Olfr980 UTSW 9 40006268 missense probably damaging 1.00
R4732:Olfr980 UTSW 9 40006268 missense probably damaging 1.00
R4733:Olfr980 UTSW 9 40006268 missense probably damaging 1.00
R4825:Olfr980 UTSW 9 40006742 missense possibly damaging 0.72
R5619:Olfr980 UTSW 9 40006743 missense probably benign 0.07
R5770:Olfr980 UTSW 9 40006338 missense probably benign 0.01
R5791:Olfr980 UTSW 9 40006734 missense probably damaging 1.00
R6813:Olfr980 UTSW 9 40006457 missense probably benign
R6819:Olfr980 UTSW 9 40006548 missense probably benign 0.00
R6970:Olfr980 UTSW 9 40006713 missense probably benign 0.00
R7490:Olfr980 UTSW 9 40006424 missense probably damaging 1.00
R7511:Olfr980 UTSW 9 40006933 missense possibly damaging 0.63
R7933:Olfr980 UTSW 9 40007135 start gained probably benign
R8243:Olfr980 UTSW 9 40006188 missense probably benign 0.19
Z1088:Olfr980 UTSW 9 40006596 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTCAGGTAGATGAAAACACAGGGC -3'
(R):5'- TCAGTTACCCACTCAGGTACAGCAG -3'

Sequencing Primer
(F):5'- TGAAAACACAGGGCACAAAG -3'
(R):5'- CTCAGGTACAGCAGCATGATG -3'
Posted On2013-05-09