Incidental Mutation 'R4393:Teddm1a'
ID 326452
Institutional Source Beutler Lab
Gene Symbol Teddm1a
Ensembl Gene ENSMUSG00000047053
Gene Name transmembrane epididymal protein 1A
Synonyms e9-1, Teddm1, Epdd1
MMRRC Submission 041128-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.518) question?
Stock # R4393 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 153891742-153893058 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 153892446 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 219 (D219Y)
Ref Sequence ENSEMBL: ENSMUSP00000062098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050660] [ENSMUST00000123490]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000050660
AA Change: D219Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062098
Gene: ENSMUSG00000047053
AA Change: D219Y

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
transmembrane domain 54 76 N/A INTRINSIC
Pfam:DUF716 126 246 9.4e-28 PFAM
low complexity region 282 293 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123490
SMART Domains Protein: ENSMUSP00000115023
Gene: ENSMUSG00000045968

DomainStartEndE-ValueType
Pfam:DUF716 71 195 6.1e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194459
Meta Mutation Damage Score 0.6617 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.5%
  • 20x: 92.4%
Validation Efficiency 95% (71/75)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433N12Rik C A 9: 3,134,944 noncoding transcript Het
Adgrg4 T G X: 56,932,343 L2193V probably damaging Het
Adgrl1 T C 8: 83,938,593 V1353A probably benign Het
Casc1 T C 6: 145,194,578 T166A possibly damaging Het
Cep68 A T 11: 20,238,544 N620K probably benign Het
Clcnkb A G 4: 141,412,236 S152P probably benign Het
Crybg3 A G 16: 59,560,095 probably benign Het
Cyp26c1 G A 19: 37,686,657 R142H probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dlg5 T A 14: 24,177,989 probably null Het
Ebf3 C T 7: 137,225,157 R342H probably damaging Het
Ece2 T C 16: 20,632,848 V380A probably damaging Het
Epb41l4a C T 18: 33,891,420 probably null Het
Erbb3 G T 10: 128,572,770 Q815K probably damaging Het
Ercc3 T A 18: 32,265,621 M651K probably benign Het
Fam3b C A 16: 97,481,786 probably null Het
Foxp2 A C 6: 15,377,690 probably benign Het
Gdf10 T C 14: 33,932,738 Y401H probably damaging Het
Gm21738 G C 14: 19,417,178 L117V probably benign Het
Gm6408 A T 5: 146,482,337 D54V probably damaging Het
Gm8909 C A 17: 36,161,969 probably benign Het
Hcn4 A G 9: 58,844,300 E403G unknown Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hjurp A G 1: 88,266,561 probably benign Het
Hyou1 T A 9: 44,381,872 V125E probably damaging Het
Il11ra1 T C 4: 41,768,577 probably null Het
Immt T A 6: 71,872,800 S435T probably benign Het
Kcnip2 A G 19: 45,812,230 L19P probably benign Het
Kctd2 T C 11: 115,429,500 probably benign Het
Mdga1 T C 17: 29,850,517 D185G probably damaging Het
Mdn1 C T 4: 32,754,482 T4666M possibly damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Msl2 A G 9: 101,101,477 E350G probably damaging Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Myo3a A T 2: 22,577,854 K373N probably damaging Het
Nr5a1 T C 2: 38,694,219 E396G probably damaging Het
Ogdh G A 11: 6,316,772 G141D probably damaging Het
Olfr1133 A T 2: 87,645,912 C70* probably null Het
Olfr1491 T C 19: 13,705,190 I121T possibly damaging Het
Olfr92 T C 17: 37,114,084 probably benign Het
Orc2 C A 1: 58,467,650 probably null Het
P4ha3 C T 7: 100,305,607 P291S probably benign Het
Pign T C 1: 105,522,026 K925R probably benign Het
Plekhm1 A G 11: 103,376,965 S727P possibly damaging Het
Prr36 G T 8: 4,214,901 probably benign Het
Prrt3 A G 6: 113,494,946 L755P probably benign Het
Secisbp2 A G 13: 51,654,466 H89R probably damaging Het
Sgms2 A T 3: 131,341,817 probably null Het
Slc35d3 T C 10: 19,849,606 probably null Het
Slu7 T A 11: 43,439,269 N174K possibly damaging Het
Tgtp1 C A 11: 48,987,623 G85V probably damaging Het
Tmem51 T C 4: 142,031,931 T169A probably benign Het
Tmem69 C T 4: 116,554,767 probably null Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Vwa3b T C 1: 37,045,178 V144A probably damaging Het
Zdhhc21 A G 4: 82,847,654 C15R possibly damaging Het
Zfp142 T C 1: 74,572,060 T756A probably benign Het
Zfp606 C T 7: 12,492,849 S241F probably damaging Het
Zfp804a A T 2: 82,256,921 T365S probably benign Het
Other mutations in Teddm1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02394:Teddm1a APN 1 153891799 missense probably benign 0.02
IGL03224:Teddm1a APN 1 153892017 missense possibly damaging 0.76
R0279:Teddm1a UTSW 1 153892623 missense probably damaging 1.00
R1108:Teddm1a UTSW 1 153892320 missense probably damaging 1.00
R3036:Teddm1a UTSW 1 153891910 missense probably benign
R4686:Teddm1a UTSW 1 153892450 missense probably damaging 1.00
R4855:Teddm1a UTSW 1 153892636 missense probably benign 0.05
R4967:Teddm1a UTSW 1 153892233 nonsense probably null
R5260:Teddm1a UTSW 1 153891900 missense probably benign 0.01
R6114:Teddm1a UTSW 1 153891868 missense probably damaging 1.00
R6559:Teddm1a UTSW 1 153892365 missense probably benign
R7030:Teddm1a UTSW 1 153892623 missense probably damaging 1.00
Z1088:Teddm1a UTSW 1 153892026 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AATCATCTGGGGTGGAGCTG -3'
(R):5'- TGCAGCAGCTTGTAGAAGGTTC -3'

Sequencing Primer
(F):5'- TGGAGCTGCAGGTTCACTCTC -3'
(R):5'- TAGAAGGTTCCTGAAGAGCTCTCC -3'
Posted On 2015-07-06