Incidental Mutation 'R4393:Zdhhc21'
ID326460
Institutional Source Beutler Lab
Gene Symbol Zdhhc21
Ensembl Gene ENSMUSG00000028403
Gene Namezinc finger, DHHC domain containing 21
Synonyms9130404H11Rik, D130004H04Rik, dep
MMRRC Submission 041128-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R4393 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location82798738-82859958 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82847654 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 15 (C15R)
Ref Sequence ENSEMBL: ENSMUSP00000133630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030110] [ENSMUST00000107239] [ENSMUST00000139401] [ENSMUST00000156055] [ENSMUST00000173741]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030110
AA Change: C15R

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000030110
Gene: ENSMUSG00000028403
AA Change: C15R

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 43 58 N/A INTRINSIC
Pfam:zf-DHHC 61 217 5.6e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107239
AA Change: C15R

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102859
Gene: ENSMUSG00000028403
AA Change: C15R

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 45 65 N/A INTRINSIC
Pfam:zf-DHHC 85 218 3.6e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000139401
AA Change: C15R

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000121954
Gene: ENSMUSG00000028403
AA Change: C15R

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 43 58 N/A INTRINSIC
Pfam:zf-DHHC 61 110 3e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144139
Predicted Effect probably benign
Transcript: ENSMUST00000156055
AA Change: C15R

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect possibly damaging
Transcript: ENSMUST00000173741
AA Change: C15R

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133630
Gene: ENSMUSG00000028403
AA Change: C15R

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 43 58 N/A INTRINSIC
Pfam:zf-DHHC 61 125 1.5e-16 PFAM
Meta Mutation Damage Score 0.2010 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.5%
  • 20x: 92.4%
Validation Efficiency 95% (71/75)
MGI Phenotype PHENOTYPE: Homozygous mutants of this epidermal acting gene have thin, short hair, many misshapen and disoriented hair follicles, and clumps of pigment reflecting remains of degenerating follicles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433N12Rik C A 9: 3,134,944 noncoding transcript Het
Adgrg4 T G X: 56,932,343 L2193V probably damaging Het
Adgrl1 T C 8: 83,938,593 V1353A probably benign Het
Casc1 T C 6: 145,194,578 T166A possibly damaging Het
Cep68 A T 11: 20,238,544 N620K probably benign Het
Clcnkb A G 4: 141,412,236 S152P probably benign Het
Crybg3 A G 16: 59,560,095 probably benign Het
Cyp26c1 G A 19: 37,686,657 R142H probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dlg5 T A 14: 24,177,989 probably null Het
Ebf3 C T 7: 137,225,157 R342H probably damaging Het
Ece2 T C 16: 20,632,848 V380A probably damaging Het
Epb41l4a C T 18: 33,891,420 probably null Het
Erbb3 G T 10: 128,572,770 Q815K probably damaging Het
Ercc3 T A 18: 32,265,621 M651K probably benign Het
Fam3b C A 16: 97,481,786 probably null Het
Foxp2 A C 6: 15,377,690 probably benign Het
Gdf10 T C 14: 33,932,738 Y401H probably damaging Het
Gm21738 G C 14: 19,417,178 L117V probably benign Het
Gm6408 A T 5: 146,482,337 D54V probably damaging Het
Gm8909 C A 17: 36,161,969 probably benign Het
Hcn4 A G 9: 58,844,300 E403G unknown Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hjurp A G 1: 88,266,561 probably benign Het
Hyou1 T A 9: 44,381,872 V125E probably damaging Het
Il11ra1 T C 4: 41,768,577 probably null Het
Immt T A 6: 71,872,800 S435T probably benign Het
Kcnip2 A G 19: 45,812,230 L19P probably benign Het
Kctd2 T C 11: 115,429,500 probably benign Het
Mdga1 T C 17: 29,850,517 D185G probably damaging Het
Mdn1 C T 4: 32,754,482 T4666M possibly damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Msl2 A G 9: 101,101,477 E350G probably damaging Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Myo3a A T 2: 22,577,854 K373N probably damaging Het
Nr5a1 T C 2: 38,694,219 E396G probably damaging Het
Ogdh G A 11: 6,316,772 G141D probably damaging Het
Olfr1133 A T 2: 87,645,912 C70* probably null Het
Olfr1491 T C 19: 13,705,190 I121T possibly damaging Het
Olfr92 T C 17: 37,114,084 probably benign Het
Orc2 C A 1: 58,467,650 probably null Het
P4ha3 C T 7: 100,305,607 P291S probably benign Het
Pign T C 1: 105,522,026 K925R probably benign Het
Plekhm1 A G 11: 103,376,965 S727P possibly damaging Het
Prr36 G T 8: 4,214,901 probably benign Het
Prrt3 A G 6: 113,494,946 L755P probably benign Het
Secisbp2 A G 13: 51,654,466 H89R probably damaging Het
Sgms2 A T 3: 131,341,817 probably null Het
Slc35d3 T C 10: 19,849,606 probably null Het
Slu7 T A 11: 43,439,269 N174K possibly damaging Het
Teddm1a G T 1: 153,892,446 D219Y probably damaging Het
Tgtp1 C A 11: 48,987,623 G85V probably damaging Het
Tmem51 T C 4: 142,031,931 T169A probably benign Het
Tmem69 C T 4: 116,554,767 probably null Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Vwa3b T C 1: 37,045,178 V144A probably damaging Het
Zfp142 T C 1: 74,572,060 T756A probably benign Het
Zfp606 C T 7: 12,492,849 S241F probably damaging Het
Zfp804a A T 2: 82,256,921 T365S probably benign Het
Other mutations in Zdhhc21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02887:Zdhhc21 APN 4 82844190 missense probably benign 0.43
IGL03172:Zdhhc21 APN 4 82806327 utr 3 prime probably benign
R4701:Zdhhc21 UTSW 4 82820334 missense possibly damaging 0.92
R4910:Zdhhc21 UTSW 4 82820331 missense possibly damaging 0.68
R5288:Zdhhc21 UTSW 4 82847692 missense probably damaging 1.00
R5339:Zdhhc21 UTSW 4 82838313 missense probably damaging 1.00
R6363:Zdhhc21 UTSW 4 82847674 missense probably damaging 1.00
R8435:Zdhhc21 UTSW 4 82835477 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACGCTGTACTTCAAAACATTCAC -3'
(R):5'- CCTGTGATGTTAGCCTCCTG -3'

Sequencing Primer
(F):5'- TGCCAGGAATATGTCCTTC -3'
(R):5'- GCCTCCTGGTTAAAGTGCTAAGAC -3'
Posted On2015-07-06