Incidental Mutation 'R4393:Hyou1'
ID 326477
Institutional Source Beutler Lab
Gene Symbol Hyou1
Ensembl Gene ENSMUSG00000032115
Gene Name hypoxia up-regulated 1
Synonyms 140 kDa, Orp150, Cab140, Grp170, CBP-140
MMRRC Submission 041128-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4393 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 44290840-44303662 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 44293169 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 125 (V125E)
Ref Sequence ENSEMBL: ENSMUSP00000124177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066601] [ENSMUST00000159473] [ENSMUST00000160902] [ENSMUST00000161318] [ENSMUST00000162560] [ENSMUST00000217019]
AlphaFold Q9JKR6
Predicted Effect probably damaging
Transcript: ENSMUST00000066601
AA Change: V176E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000068594
Gene: ENSMUSG00000032115
AA Change: V176E

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 669 1.3e-101 PFAM
Pfam:HSP70 690 814 2.1e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159473
AA Change: V125E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124177
Gene: ENSMUSG00000032115
AA Change: V125E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:HSP70 38 226 2e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160112
Predicted Effect probably damaging
Transcript: ENSMUST00000160902
AA Change: V176E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125594
Gene: ENSMUSG00000032115
AA Change: V176E

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 671 3.8e-101 PFAM
Pfam:HSP70 690 814 1.2e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161318
AA Change: V176E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123700
Gene: ENSMUSG00000032115
AA Change: V176E

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 671 3.8e-101 PFAM
Pfam:HSP70 690 814 1.2e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161537
Predicted Effect probably benign
Transcript: ENSMUST00000162560
SMART Domains Protein: ENSMUSP00000123749
Gene: ENSMUSG00000032115

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 168 6.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217460
Meta Mutation Damage Score 0.9649 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.5%
  • 20x: 92.4%
Validation Efficiency 95% (71/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the heat shock protein 70 family. This gene uses alternative transcription start sites. A cis-acting segment found in the 5' UTR is involved in stress-dependent induction, resulting in the accumulation of this protein in the endoplasmic reticulum (ER) under hypoxic conditions. The protein encoded by this gene is thought to play an important role in protein folding and secretion in the ER. Since suppression of the protein is associated with accelerated apoptosis, it is also suggested to have an important cytoprotective role in hypoxia-induced cellular perturbation. This protein has been shown to be up-regulated in tumors, especially in breast tumors, and thus it is associated with tumor invasiveness. This gene also has an alternative translation initiation site, resulting in a protein that lacks the N-terminal signal peptide. This signal peptide-lacking protein, which is only 3 amino acids shorter than the mature protein in the ER, is thought to have a housekeeping function in the cytosol. In rat, this protein localizes to both the ER by a carboxy-terminal peptide sequence and to mitochondria by an amino-terminal targeting signal. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice display embryonic lethality. Heterozygous mice display increased susceptibility to induced neuronal cell death. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Gene trapped(5)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433N12Rik C A 9: 3,134,944 (GRCm39) noncoding transcript Het
Adgrg4 T G X: 55,977,703 (GRCm39) L2193V probably damaging Het
Adgrl1 T C 8: 84,665,222 (GRCm39) V1353A probably benign Het
Cep68 A T 11: 20,188,544 (GRCm39) N620K probably benign Het
Clcnkb A G 4: 141,139,547 (GRCm39) S152P probably benign Het
Crybg3 A G 16: 59,380,458 (GRCm39) probably benign Het
Cyp26c1 G A 19: 37,675,105 (GRCm39) R142H probably damaging Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Dlg5 T A 14: 24,228,057 (GRCm39) probably null Het
Dnai7 T C 6: 145,140,304 (GRCm39) T166A possibly damaging Het
Ebf3 C T 7: 136,826,886 (GRCm39) R342H probably damaging Het
Ece2 T C 16: 20,451,598 (GRCm39) V380A probably damaging Het
Epb41l4a C T 18: 34,024,473 (GRCm39) probably null Het
Erbb3 G T 10: 128,408,639 (GRCm39) Q815K probably damaging Het
Ercc3 T A 18: 32,398,674 (GRCm39) M651K probably benign Het
Fam3b C A 16: 97,282,986 (GRCm39) probably null Het
Foxp2 A C 6: 15,377,689 (GRCm39) probably benign Het
Gdf10 T C 14: 33,654,695 (GRCm39) Y401H probably damaging Het
Gm21738 G C 14: 19,417,178 (GRCm38) L117V probably benign Het
Gm6408 A T 5: 146,419,147 (GRCm39) D54V probably damaging Het
H2-T5 C A 17: 36,472,861 (GRCm39) probably benign Het
Hcn4 A G 9: 58,751,583 (GRCm39) E403G unknown Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hjurp A G 1: 88,194,283 (GRCm39) probably benign Het
Il11ra1 T C 4: 41,768,577 (GRCm39) probably null Het
Immt T A 6: 71,849,784 (GRCm39) S435T probably benign Het
Kcnip2 A G 19: 45,800,669 (GRCm39) L19P probably benign Het
Kctd2 T C 11: 115,320,326 (GRCm39) probably benign Het
Mdga1 T C 17: 30,069,491 (GRCm39) D185G probably damaging Het
Mdn1 C T 4: 32,754,482 (GRCm39) T4666M possibly damaging Het
Mfsd13a C T 19: 46,360,431 (GRCm39) R328C probably damaging Het
Msl2 A G 9: 100,978,676 (GRCm39) E350G probably damaging Het
Muc4 C A 16: 32,754,529 (GRCm38) H1468N probably benign Het
Myo3a A T 2: 22,467,866 (GRCm39) K373N probably damaging Het
Nr5a1 T C 2: 38,584,231 (GRCm39) E396G probably damaging Het
Ogdh G A 11: 6,266,772 (GRCm39) G141D probably damaging Het
Or10q1b T C 19: 13,682,554 (GRCm39) I121T possibly damaging Het
Or2h2c T C 17: 37,424,971 (GRCm39) probably benign Het
Or5w1b A T 2: 87,476,256 (GRCm39) C70* probably null Het
Orc2 C A 1: 58,506,809 (GRCm39) probably null Het
P4ha3 C T 7: 99,954,814 (GRCm39) P291S probably benign Het
Pign T C 1: 105,449,751 (GRCm39) K925R probably benign Het
Plekhm1 A G 11: 103,267,791 (GRCm39) S727P possibly damaging Het
Prr36 G T 8: 4,264,901 (GRCm39) probably benign Het
Prrt3 A G 6: 113,471,907 (GRCm39) L755P probably benign Het
Secisbp2 A G 13: 51,808,502 (GRCm39) H89R probably damaging Het
Sgms2 A T 3: 131,135,466 (GRCm39) probably null Het
Slc35d3 T C 10: 19,725,352 (GRCm39) probably null Het
Slu7 T A 11: 43,330,096 (GRCm39) N174K possibly damaging Het
Teddm1a G T 1: 153,768,192 (GRCm39) D219Y probably damaging Het
Tgtp1 C A 11: 48,878,450 (GRCm39) G85V probably damaging Het
Tmem51 T C 4: 141,759,242 (GRCm39) T169A probably benign Het
Tmem69 C T 4: 116,411,964 (GRCm39) probably null Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,139,706 (GRCm39) probably benign Het
Ugt1a10 C T 1: 88,142,845 (GRCm39) P113L probably damaging Het
Vmn2r79 A G 7: 86,651,099 (GRCm39) H166R possibly damaging Het
Vwa3b T C 1: 37,084,259 (GRCm39) V144A probably damaging Het
Zdhhc21 A G 4: 82,765,891 (GRCm39) C15R possibly damaging Het
Zfp142 T C 1: 74,611,219 (GRCm39) T756A probably benign Het
Zfp606 C T 7: 12,226,776 (GRCm39) S241F probably damaging Het
Zfp804a A T 2: 82,087,265 (GRCm39) T365S probably benign Het
Other mutations in Hyou1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Hyou1 APN 9 44,296,443 (GRCm39) missense probably benign 0.02
IGL01660:Hyou1 APN 9 44,292,414 (GRCm39) missense possibly damaging 0.75
IGL01677:Hyou1 APN 9 44,293,309 (GRCm39) missense probably benign 0.21
IGL01903:Hyou1 APN 9 44,292,438 (GRCm39) splice site probably benign
IGL02636:Hyou1 APN 9 44,292,707 (GRCm39) critical splice donor site probably null
IGL02806:Hyou1 APN 9 44,300,180 (GRCm39) nonsense probably null
IGL03401:Hyou1 APN 9 44,296,206 (GRCm39) missense probably damaging 1.00
IGL03410:Hyou1 APN 9 44,299,355 (GRCm39) missense probably benign
ANU74:Hyou1 UTSW 9 44,292,560 (GRCm39) missense possibly damaging 0.79
D3080:Hyou1 UTSW 9 44,295,774 (GRCm39) missense probably damaging 0.97
PIT4378001:Hyou1 UTSW 9 44,302,148 (GRCm39) missense probably benign 0.26
R0408:Hyou1 UTSW 9 44,295,989 (GRCm39) missense probably damaging 1.00
R0422:Hyou1 UTSW 9 44,300,539 (GRCm39) missense probably damaging 1.00
R1116:Hyou1 UTSW 9 44,295,978 (GRCm39) missense probably damaging 1.00
R1581:Hyou1 UTSW 9 44,300,167 (GRCm39) missense probably damaging 1.00
R1640:Hyou1 UTSW 9 44,300,703 (GRCm39) missense probably benign 0.02
R1803:Hyou1 UTSW 9 44,295,479 (GRCm39) nonsense probably null
R2060:Hyou1 UTSW 9 44,292,849 (GRCm39) missense probably benign 0.28
R2180:Hyou1 UTSW 9 44,299,316 (GRCm39) missense probably benign 0.30
R2233:Hyou1 UTSW 9 44,300,388 (GRCm39) missense probably benign 0.44
R2235:Hyou1 UTSW 9 44,300,388 (GRCm39) missense probably benign 0.44
R3950:Hyou1 UTSW 9 44,296,524 (GRCm39) missense probably damaging 1.00
R4198:Hyou1 UTSW 9 44,300,156 (GRCm39) missense probably damaging 1.00
R4200:Hyou1 UTSW 9 44,300,156 (GRCm39) missense probably damaging 1.00
R4363:Hyou1 UTSW 9 44,291,912 (GRCm39) splice site probably null
R4394:Hyou1 UTSW 9 44,293,169 (GRCm39) missense probably damaging 1.00
R4812:Hyou1 UTSW 9 44,298,418 (GRCm39) intron probably benign
R5239:Hyou1 UTSW 9 44,296,560 (GRCm39) missense possibly damaging 0.96
R5648:Hyou1 UTSW 9 44,296,546 (GRCm39) missense probably damaging 0.99
R5818:Hyou1 UTSW 9 44,300,223 (GRCm39) critical splice donor site probably null
R5856:Hyou1 UTSW 9 44,292,641 (GRCm39) missense probably damaging 1.00
R6431:Hyou1 UTSW 9 44,293,322 (GRCm39) critical splice donor site probably null
R6594:Hyou1 UTSW 9 44,300,619 (GRCm39) missense probably benign
R6596:Hyou1 UTSW 9 44,299,052 (GRCm39) missense probably benign 0.00
R6613:Hyou1 UTSW 9 44,293,795 (GRCm39) missense probably damaging 0.99
R6704:Hyou1 UTSW 9 44,292,431 (GRCm39) critical splice donor site probably null
R6849:Hyou1 UTSW 9 44,298,561 (GRCm39) missense probably damaging 0.99
R7494:Hyou1 UTSW 9 44,300,706 (GRCm39) missense probably benign 0.04
R7632:Hyou1 UTSW 9 44,292,433 (GRCm39) splice site probably null
R7711:Hyou1 UTSW 9 44,295,759 (GRCm39) missense possibly damaging 0.91
R8064:Hyou1 UTSW 9 44,296,882 (GRCm39) missense possibly damaging 0.80
R8287:Hyou1 UTSW 9 44,299,430 (GRCm39) missense probably benign 0.26
R9352:Hyou1 UTSW 9 44,300,926 (GRCm39) critical splice donor site probably null
R9385:Hyou1 UTSW 9 44,292,812 (GRCm39) missense probably benign 0.06
X0027:Hyou1 UTSW 9 44,302,153 (GRCm39) missense possibly damaging 0.89
Z1176:Hyou1 UTSW 9 44,299,039 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAGCATCAAGGTGGTGCTG -3'
(R):5'- GTATGTATTCAGTGGCTCACCTG -3'

Sequencing Primer
(F):5'- TAGCAAGCAGAGCCTCTTTG -3'
(R):5'- CTCACCTGTGCAGTGGAATTGATATC -3'
Posted On 2015-07-06