Incidental Mutation 'R4393:Msl2'
ID326478
Institutional Source Beutler Lab
Gene Symbol Msl2
Ensembl Gene ENSMUSG00000066415
Gene NameMSL complex subunit 2
SynonymsMsl2l1, Rnf184
MMRRC Submission 041128-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R4393 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location101074101-101104800 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101101477 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 350 (E350G)
Ref Sequence ENSEMBL: ENSMUSP00000082270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066773] [ENSMUST00000075941] [ENSMUST00000085177] [ENSMUST00000189616]
Predicted Effect probably benign
Transcript: ENSMUST00000066773
SMART Domains Protein: ENSMUSP00000069688
Gene: ENSMUSG00000043154

DomainStartEndE-ValueType
Blast:EFh 140 169 1e-9 BLAST
Pfam:EF-hand_7 282 380 2.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075941
SMART Domains Protein: ENSMUSP00000075327
Gene: ENSMUSG00000043154

DomainStartEndE-ValueType
low complexity region 248 266 N/A INTRINSIC
Blast:EFh 760 789 1e-9 BLAST
Pfam:EF-hand_7 902 1000 2.5e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000085177
AA Change: E350G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082270
Gene: ENSMUSG00000066415
AA Change: E350G

DomainStartEndE-ValueType
Pfam:zf-RING_10 42 111 2.8e-36 PFAM
low complexity region 265 281 N/A INTRINSIC
low complexity region 340 351 N/A INTRINSIC
low complexity region 406 424 N/A INTRINSIC
CXC 457 504 1.6e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189616
SMART Domains Protein: ENSMUSP00000139396
Gene: ENSMUSG00000066415

DomainStartEndE-ValueType
PDB:4B86|L 1 47 2e-28 PDB
Meta Mutation Damage Score 0.2252 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.5%
  • 20x: 92.4%
Validation Efficiency 95% (71/75)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433N12Rik C A 9: 3,134,944 noncoding transcript Het
Adgrg4 T G X: 56,932,343 L2193V probably damaging Het
Adgrl1 T C 8: 83,938,593 V1353A probably benign Het
Casc1 T C 6: 145,194,578 T166A possibly damaging Het
Cep68 A T 11: 20,238,544 N620K probably benign Het
Clcnkb A G 4: 141,412,236 S152P probably benign Het
Crybg3 A G 16: 59,560,095 probably benign Het
Cyp26c1 G A 19: 37,686,657 R142H probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dlg5 T A 14: 24,177,989 probably null Het
Ebf3 C T 7: 137,225,157 R342H probably damaging Het
Ece2 T C 16: 20,632,848 V380A probably damaging Het
Epb41l4a C T 18: 33,891,420 probably null Het
Erbb3 G T 10: 128,572,770 Q815K probably damaging Het
Ercc3 T A 18: 32,265,621 M651K probably benign Het
Fam3b C A 16: 97,481,786 probably null Het
Foxp2 A C 6: 15,377,690 probably benign Het
Gdf10 T C 14: 33,932,738 Y401H probably damaging Het
Gm21738 G C 14: 19,417,178 L117V probably benign Het
Gm6408 A T 5: 146,482,337 D54V probably damaging Het
Gm8909 C A 17: 36,161,969 probably benign Het
Hcn4 A G 9: 58,844,300 E403G unknown Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hjurp A G 1: 88,266,561 probably benign Het
Hyou1 T A 9: 44,381,872 V125E probably damaging Het
Il11ra1 T C 4: 41,768,577 probably null Het
Immt T A 6: 71,872,800 S435T probably benign Het
Kcnip2 A G 19: 45,812,230 L19P probably benign Het
Kctd2 T C 11: 115,429,500 probably benign Het
Mdga1 T C 17: 29,850,517 D185G probably damaging Het
Mdn1 C T 4: 32,754,482 T4666M possibly damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Myo3a A T 2: 22,577,854 K373N probably damaging Het
Nr5a1 T C 2: 38,694,219 E396G probably damaging Het
Ogdh G A 11: 6,316,772 G141D probably damaging Het
Olfr1133 A T 2: 87,645,912 C70* probably null Het
Olfr1491 T C 19: 13,705,190 I121T possibly damaging Het
Olfr92 T C 17: 37,114,084 probably benign Het
Orc2 C A 1: 58,467,650 probably null Het
P4ha3 C T 7: 100,305,607 P291S probably benign Het
Pign T C 1: 105,522,026 K925R probably benign Het
Plekhm1 A G 11: 103,376,965 S727P possibly damaging Het
Prr36 G T 8: 4,214,901 probably benign Het
Prrt3 A G 6: 113,494,946 L755P probably benign Het
Secisbp2 A G 13: 51,654,466 H89R probably damaging Het
Sgms2 A T 3: 131,341,817 probably null Het
Slc35d3 T C 10: 19,849,606 probably null Het
Slu7 T A 11: 43,439,269 N174K possibly damaging Het
Teddm1a G T 1: 153,892,446 D219Y probably damaging Het
Tgtp1 C A 11: 48,987,623 G85V probably damaging Het
Tmem51 T C 4: 142,031,931 T169A probably benign Het
Tmem69 C T 4: 116,554,767 probably null Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Vwa3b T C 1: 37,045,178 V144A probably damaging Het
Zdhhc21 A G 4: 82,847,654 C15R possibly damaging Het
Zfp142 T C 1: 74,572,060 T756A probably benign Het
Zfp606 C T 7: 12,492,849 S241F probably damaging Het
Zfp804a A T 2: 82,256,921 T365S probably benign Het
Other mutations in Msl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Msl2 APN 9 101101070 missense probably benign 0.13
IGL02496:Msl2 APN 9 101100655 missense possibly damaging 0.93
IGL02798:Msl2 APN 9 101075377 missense probably benign 0.06
IGL03235:Msl2 APN 9 101100768 missense probably benign 0.03
anguished UTSW 9 101101975 missense possibly damaging 0.66
Appalled UTSW 9 101100843 missense probably benign
Crestfallen UTSW 9 101101091 nonsense probably null
R0497:Msl2 UTSW 9 101101294 missense probably benign 0.00
R1288:Msl2 UTSW 9 101102109 missense probably benign 0.01
R2015:Msl2 UTSW 9 101075251 start gained probably benign
R2038:Msl2 UTSW 9 101101984 missense probably damaging 1.00
R2238:Msl2 UTSW 9 101101370 missense probably benign 0.41
R4827:Msl2 UTSW 9 101102151 missense probably benign 0.00
R5290:Msl2 UTSW 9 101101407 unclassified probably null
R5567:Msl2 UTSW 9 101101737 missense possibly damaging 0.67
R5934:Msl2 UTSW 9 101101818 missense probably damaging 1.00
R5940:Msl2 UTSW 9 101101091 nonsense probably null
R6339:Msl2 UTSW 9 101101750 missense probably benign
R6736:Msl2 UTSW 9 101101002 missense probably damaging 0.99
R6950:Msl2 UTSW 9 101101975 missense possibly damaging 0.66
R6971:Msl2 UTSW 9 101100843 missense probably benign
R7022:Msl2 UTSW 9 101075282 missense possibly damaging 0.91
R7408:Msl2 UTSW 9 101102117 missense probably benign 0.08
R7955:Msl2 UTSW 9 101102155 missense possibly damaging 0.69
R8069:Msl2 UTSW 9 101100960 missense probably benign
R8281:Msl2 UTSW 9 101101695 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGGAAGCCACTGTATCCAATG -3'
(R):5'- AATACCTGGCTTGGATTTAGAGTG -3'

Sequencing Primer
(F):5'- GTTTTCATGTCCACCAGC -3'
(R):5'- GATTTCTTGGATCCATGTTCATGAC -3'
Posted On2015-07-06