Mutagenetix > Incidental Mutation

Incidental Mutation 'R0013:Uba7'

32649

Institutional Source

Beutler Lab

Gene Symbol

Uba7

Ensembl Gene

ENSMUSG00000032596

Gene Name

ubiquitin-like modifier activating enzyme 7

Synonyms

1300004C08Rik, Ube1l

MMRRC Submission

038308-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.100) question?

Stock #

R0013 (G1)

Quality Score

202

Status

Validated

Chromosome

Chromosomal Location

107975505-107984060 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 107978249 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 375 (Y375F)

Ref Sequence

ENSEMBL: ENSMUSP00000134910 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035216] [ENSMUST00000177392]

AlphaFold

Q9DBK7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000035216
AA Change: Y375F

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000035216
Gene: ENSMUSG00000032596
AA Change: Y375F

Domain	Start	End	E-Value	Type
Pfam:ThiF	6	401	1.2e-33	PFAM
Pfam:E1_FCCH	178	249	1.1e-26	PFAM
Pfam:E1_4HB	250	318	2.5e-22	PFAM
internal_repeat_1	402	510	8.05e-5	PROSPERO
Pfam:UBA_e1_thiolCys	592	808	1.3e-50	PFAM
UBA_e1_C	846	973	4.63e-65	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000075082

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175933

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176037

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176166

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176340

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176382

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176478

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176673

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176743

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176842

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176858

Predicted Effect

probably benign
Transcript: ENSMUST00000177039

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177071

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177096

Predicted Effect

probably damaging
Transcript: ENSMUST00000177392
AA Change: Y375F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134910
Gene: ENSMUSG00000032596
AA Change: Y375F

Domain	Start	End	E-Value	Type
Pfam:ThiF	22	153	1.2e-18	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177494

Meta Mutation Damage Score

0.2990

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.8%

Validation Efficiency

94% (79/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E1 ubiquitin-activating enzyme family. The encoded enzyme is a retinoid target that triggers promyelocytic leukemia (PML)/retinoic acid receptor alpha (RARalpha) degradation and apoptosis in acute promyelocytic leukemia, where it is involved in the conjugation of the ubiquitin-like interferon-stimulated gene 15 protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice lacking ISG15 conjugation but not free ISG15 are healthy and fertile and exhibit normal antiviral responses against vesicular stomatitis virus and lymphocytic choriomeningitis virus infection. Bone-derived macrophages from mutant mice display normal responses to IFN treatment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610028H24Rik	A	G	10: 76,457,512	M156V	probably benign	Het
Adnp2	A	T	18: 80,129,745	V483D	probably damaging	Het
Aff1	G	T	5: 103,828,484	E491*	probably null	Het
Agl	A	T	3: 116,776,608	C911*	probably null	Het
Akt2	A	G	7: 27,636,058	D284G	probably damaging	Het
Alox15	A	G	11: 70,349,635	M240T	possibly damaging	Het
Antxr2	A	G	5: 97,979,985	V229A	probably damaging	Het
Arap2	G	A	5: 62,683,484	L680F	probably damaging	Het
Btaf1	A	G	19: 36,958,373	T188A	probably benign	Het
Btnl6	G	A	17: 34,515,531	Q86*	probably null	Het
C2cd3	T	A	7: 100,416,062	L685H	probably damaging	Het
Cdh23	T	C	10: 60,413,173	T878A	possibly damaging	Het
Clec4b2	T	C	6: 123,202,149	Y137H	probably damaging	Het
Dchs1	T	A	7: 105,755,836	T2500S	possibly damaging	Het
Def6	A	G	17: 28,217,092	Y75C	probably damaging	Het
Dhx33	A	T	11: 70,993,635	F448L	probably damaging	Het
Dner	C	T	1: 84,494,893		probably benign	Het
Dnmbp	G	A	19: 43,902,231	P366S	probably benign	Het
Eif4g3	T	C	4: 138,175,848	C1160R	possibly damaging	Het
Elmod1	G	A	9: 53,912,901		probably benign	Het
Faah	C	A	4: 116,004,391	L305F	probably damaging	Het
Fam71b	A	G	11: 46,406,804	T312A	unknown	Het
Flt1	A	G	5: 147,571,014		probably benign	Het
Fyco1	A	T	9: 123,822,406	N1196K	probably benign	Het
Galnt18	T	C	7: 111,554,457	N320S	probably damaging	Het
Glp2r	C	A	11: 67,709,712	G437V	possibly damaging	Het
Gm4884	T	C	7: 41,044,292	S562P	probably damaging	Het
Gm9936	A	G	5: 114,857,347		probably benign	Het
Gpn2	C	A	4: 133,584,792	P112T	probably damaging	Het
Grm4	A	G	17: 27,431,575	Y816H	probably benign	Het
Helz2	A	T	2: 181,240,959	S14T	probably benign	Het
Htt	T	C	5: 34,820,104	L778P	probably benign	Het
Il11ra1	T	C	4: 41,765,060	S129P	probably damaging	Het
Ints11	T	C	4: 155,887,168	F315S	probably damaging	Het
Itga11	A	T	9: 62,776,613	N1059Y	possibly damaging	Het
Jak3	A	G	8: 71,684,327	S716G	probably damaging	Het
Kcns1	G	T	2: 164,168,643	D65E	probably benign	Het
Kdm5d	A	T	Y: 941,715	K1305N	probably benign	Het
Kif26a	G	T	12: 112,177,880	V1523L	probably benign	Het
Mboat7	A	G	7: 3,683,822	S340P	probably damaging	Het
Mctp2	T	C	7: 72,229,408	I234V	probably benign	Het
Mex3c	G	A	18: 73,590,551	A572T	probably benign	Het
Mpp3	C	A	11: 102,005,425	R424L	probably benign	Het
Mroh4	T	A	15: 74,608,237		probably benign	Het
Myo9a	A	T	9: 59,860,206		probably benign	Het
Myog	T	A	1: 134,290,235	H60Q	probably damaging	Het
Nlrp9a	T	A	7: 26,571,225		probably null	Het
Notch1	A	G	2: 26,473,818	V868A	possibly damaging	Het
Olfr352	A	G	2: 36,870,160	N198S	probably damaging	Het
Olfr59	T	A	11: 74,289,051	I135N	possibly damaging	Het
Olfr73	T	C	2: 88,034,266	Y291C	possibly damaging	Het
Olfr980	A	T	9: 40,006,355	I198N	probably damaging	Het
Pink1	T	C	4: 138,317,401	T342A	probably benign	Het
Plb1	T	A	5: 32,349,615		probably benign	Het
Plec	T	C	15: 76,178,246	D2524G	probably damaging	Het
Plekhg4	G	T	8: 105,375,396	E6*	probably null	Het
Polq	T	C	16: 37,061,839	F1455S	possibly damaging	Het
Ppm1e	A	G	11: 87,249,058		probably benign	Het
Prkaca	G	A	8: 83,988,303	M119I	possibly damaging	Het
Prss46	G	T	9: 110,850,055	S108I	probably damaging	Het
Ptma	C	T	1: 86,529,776		probably benign	Het
Rab11fip4	C	T	11: 79,689,653	T437M	probably benign	Het
Rngtt	T	A	4: 33,379,409	M437K	probably benign	Het
Rrn3	T	A	16: 13,813,113	D604E	possibly damaging	Het
Scn4a	A	G	11: 106,348,405		probably benign	Het
Sis	A	G	3: 72,910,476	L1468P	possibly damaging	Het
Slit3	A	G	11: 35,707,918	M1450V	probably benign	Het
Smg5	T	C	3: 88,349,233	S269P	probably benign	Het
Sntg1	T	C	1: 8,463,462	T323A	probably damaging	Het
Son	C	T	16: 91,651,662	T37I	probably damaging	Het
Stk17b	T	C	1: 53,764,132	I41M	probably benign	Het
Tgm5	T	A	2: 121,076,882	Y120F	probably damaging	Het
Tppp	A	G	13: 74,021,360	K73R	possibly damaging	Het
Ttn	C	A	2: 76,739,158	K27130N	probably damaging	Het
Ttn	C	T	2: 76,907,752	V4148I	probably benign	Het
Ugcg	T	C	4: 59,213,931	L171P	possibly damaging	Het
Vsig2	T	C	9: 37,542,576		probably benign	Het
Zcchc11	T	A	4: 108,530,955		probably benign	Het
Zfp839	T	A	12: 110,868,386	S692T	possibly damaging	Het

Other mutations in Uba7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Uba7	APN	9	107979111	missense	probably benign	0.31
IGL01696:Uba7	APN	9	107977348	missense	probably damaging	1.00
IGL02137:Uba7	APN	9	107979753	splice site	probably benign
IGL02272:Uba7	APN	9	107976153	missense	probably benign	0.01
IGL02287:Uba7	APN	9	107978227	missense	probably benign	0.10
IGL02430:Uba7	APN	9	107979468	splice site	probably benign
IGL02552:Uba7	APN	9	107981390	missense	probably benign	0.00
IGL02820:Uba7	APN	9	107981516	missense	probably benign	0.01
IGL03234:Uba7	APN	9	107976400	missense	probably damaging	0.97
R0013:Uba7	UTSW	9	107978249	missense	probably damaging	1.00
R0717:Uba7	UTSW	9	107977217	missense	probably benign	0.44
R2108:Uba7	UTSW	9	107979288	missense	probably benign
R2253:Uba7	UTSW	9	107976364	missense	probably benign	0.26
R4239:Uba7	UTSW	9	107976802	critical splice donor site	probably null
R4528:Uba7	UTSW	9	107983903	missense	possibly damaging	0.79
R4735:Uba7	UTSW	9	107976916	missense	possibly damaging	0.94
R4736:Uba7	UTSW	9	107980165	missense	probably benign	0.00
R4751:Uba7	UTSW	9	107979805	missense	possibly damaging	0.66
R4937:Uba7	UTSW	9	107978991	missense	possibly damaging	0.95
R4999:Uba7	UTSW	9	107979839	critical splice donor site	probably null
R5020:Uba7	UTSW	9	107978914	missense	probably benign
R5157:Uba7	UTSW	9	107980047	missense	probably benign	0.04
R5214:Uba7	UTSW	9	107977514	intron	probably benign
R5339:Uba7	UTSW	9	107978866	missense	probably damaging	1.00
R5990:Uba7	UTSW	9	107981234	missense	probably damaging	0.96
R6092:Uba7	UTSW	9	107983160	missense	possibly damaging	0.96
R6110:Uba7	UTSW	9	107978939	missense	probably benign	0.25
R6363:Uba7	UTSW	9	107980183	critical splice donor site	probably null
R6495:Uba7	UTSW	9	107977014	nonsense	probably null
R6644:Uba7	UTSW	9	107981472	missense	possibly damaging	0.55
R7032:Uba7	UTSW	9	107976172	missense	possibly damaging	0.83
R7095:Uba7	UTSW	9	107983339	missense	probably benign	0.01
R7517:Uba7	UTSW	9	107976698	splice site	probably benign
R9083:Uba7	UTSW	9	107977967	missense	probably benign	0.00
R9227:Uba7	UTSW	9	107975802	missense	possibly damaging	0.60
R9484:Uba7	UTSW	9	107983838	missense	probably benign	0.00
X0024:Uba7	UTSW	9	107975945	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGGAGGTCCTAAAGGTAGGCAC -3'
(R):5'- CACAGCAATTTGCCCATCGTATCG -3'

Sequencing Primer
(F):5'- CAGGTAGTGTGTGTGCCAGAG -3'
(R):5'- CACAGATAATGGCCTGTGCTATG -3'

Posted On

2013-05-09