Incidental Mutation 'R0013:Uba7'
ID32649
Institutional Source Beutler Lab
Gene Symbol Uba7
Ensembl Gene ENSMUSG00000032596
Gene Nameubiquitin-like modifier activating enzyme 7
Synonyms1300004C08Rik, Ube1l
MMRRC Submission 038308-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R0013 (G1)
Quality Score202
Status Validated
Chromosome9
Chromosomal Location107975505-107984060 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107978249 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 375 (Y375F)
Ref Sequence ENSEMBL: ENSMUSP00000134910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035216] [ENSMUST00000177392]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035216
AA Change: Y375F

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000035216
Gene: ENSMUSG00000032596
AA Change: Y375F

DomainStartEndE-ValueType
Pfam:ThiF 6 401 1.2e-33 PFAM
Pfam:E1_FCCH 178 249 1.1e-26 PFAM
Pfam:E1_4HB 250 318 2.5e-22 PFAM
internal_repeat_1 402 510 8.05e-5 PROSPERO
Pfam:UBA_e1_thiolCys 592 808 1.3e-50 PFAM
UBA_e1_C 846 973 4.63e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000075082
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175933
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176166
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176340
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176382
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176858
Predicted Effect probably benign
Transcript: ENSMUST00000177039
Predicted Effect probably damaging
Transcript: ENSMUST00000177392
AA Change: Y375F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134910
Gene: ENSMUSG00000032596
AA Change: Y375F

DomainStartEndE-ValueType
Pfam:ThiF 22 153 1.2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177096
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177494
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177071
Meta Mutation Damage Score 0.2990 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 94% (79/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E1 ubiquitin-activating enzyme family. The encoded enzyme is a retinoid target that triggers promyelocytic leukemia (PML)/retinoic acid receptor alpha (RARalpha) degradation and apoptosis in acute promyelocytic leukemia, where it is involved in the conjugation of the ubiquitin-like interferon-stimulated gene 15 protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice lacking ISG15 conjugation but not free ISG15 are healthy and fertile and exhibit normal antiviral responses against vesicular stomatitis virus and lymphocytic choriomeningitis virus infection. Bone-derived macrophages from mutant mice display normal responses to IFN treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A G 10: 76,457,512 M156V probably benign Het
Adnp2 A T 18: 80,129,745 V483D probably damaging Het
Aff1 G T 5: 103,828,484 E491* probably null Het
Agl A T 3: 116,776,608 C911* probably null Het
Akt2 A G 7: 27,636,058 D284G probably damaging Het
Alox15 A G 11: 70,349,635 M240T possibly damaging Het
Antxr2 A G 5: 97,979,985 V229A probably damaging Het
Arap2 G A 5: 62,683,484 L680F probably damaging Het
Btaf1 A G 19: 36,958,373 T188A probably benign Het
Btnl6 G A 17: 34,515,531 Q86* probably null Het
C2cd3 T A 7: 100,416,062 L685H probably damaging Het
Cdh23 T C 10: 60,413,173 T878A possibly damaging Het
Clec4b2 T C 6: 123,202,149 Y137H probably damaging Het
Dchs1 T A 7: 105,755,836 T2500S possibly damaging Het
Def6 A G 17: 28,217,092 Y75C probably damaging Het
Dhx33 A T 11: 70,993,635 F448L probably damaging Het
Dner C T 1: 84,494,893 probably benign Het
Dnmbp G A 19: 43,902,231 P366S probably benign Het
Eif4g3 T C 4: 138,175,848 C1160R possibly damaging Het
Elmod1 G A 9: 53,912,901 probably benign Het
Faah C A 4: 116,004,391 L305F probably damaging Het
Fam71b A G 11: 46,406,804 T312A unknown Het
Flt1 A G 5: 147,571,014 probably benign Het
Fyco1 A T 9: 123,822,406 N1196K probably benign Het
Galnt18 T C 7: 111,554,457 N320S probably damaging Het
Glp2r C A 11: 67,709,712 G437V possibly damaging Het
Gm4884 T C 7: 41,044,292 S562P probably damaging Het
Gm9936 A G 5: 114,857,347 probably benign Het
Gpn2 C A 4: 133,584,792 P112T probably damaging Het
Grm4 A G 17: 27,431,575 Y816H probably benign Het
Helz2 A T 2: 181,240,959 S14T probably benign Het
Htt T C 5: 34,820,104 L778P probably benign Het
Il11ra1 T C 4: 41,765,060 S129P probably damaging Het
Ints11 T C 4: 155,887,168 F315S probably damaging Het
Itga11 A T 9: 62,776,613 N1059Y possibly damaging Het
Jak3 A G 8: 71,684,327 S716G probably damaging Het
Kcns1 G T 2: 164,168,643 D65E probably benign Het
Kdm5d A T Y: 941,715 K1305N probably benign Het
Kif26a G T 12: 112,177,880 V1523L probably benign Het
Mboat7 A G 7: 3,683,822 S340P probably damaging Het
Mctp2 T C 7: 72,229,408 I234V probably benign Het
Mex3c G A 18: 73,590,551 A572T probably benign Het
Mpp3 C A 11: 102,005,425 R424L probably benign Het
Mroh4 T A 15: 74,608,237 probably benign Het
Myo9a A T 9: 59,860,206 probably benign Het
Myog T A 1: 134,290,235 H60Q probably damaging Het
Nlrp9a T A 7: 26,571,225 probably null Het
Notch1 A G 2: 26,473,818 V868A possibly damaging Het
Olfr352 A G 2: 36,870,160 N198S probably damaging Het
Olfr59 T A 11: 74,289,051 I135N possibly damaging Het
Olfr73 T C 2: 88,034,266 Y291C possibly damaging Het
Olfr980 A T 9: 40,006,355 I198N probably damaging Het
Pink1 T C 4: 138,317,401 T342A probably benign Het
Plb1 T A 5: 32,349,615 probably benign Het
Plec T C 15: 76,178,246 D2524G probably damaging Het
Plekhg4 G T 8: 105,375,396 E6* probably null Het
Polq T C 16: 37,061,839 F1455S possibly damaging Het
Ppm1e A G 11: 87,249,058 probably benign Het
Prkaca G A 8: 83,988,303 M119I possibly damaging Het
Prss46 G T 9: 110,850,055 S108I probably damaging Het
Ptma C T 1: 86,529,776 probably benign Het
Rab11fip4 C T 11: 79,689,653 T437M probably benign Het
Rngtt T A 4: 33,379,409 M437K probably benign Het
Rrn3 T A 16: 13,813,113 D604E possibly damaging Het
Scn4a A G 11: 106,348,405 probably benign Het
Sis A G 3: 72,910,476 L1468P possibly damaging Het
Slit3 A G 11: 35,707,918 M1450V probably benign Het
Smg5 T C 3: 88,349,233 S269P probably benign Het
Sntg1 T C 1: 8,463,462 T323A probably damaging Het
Son C T 16: 91,651,662 T37I probably damaging Het
Stk17b T C 1: 53,764,132 I41M probably benign Het
Tgm5 T A 2: 121,076,882 Y120F probably damaging Het
Tppp A G 13: 74,021,360 K73R possibly damaging Het
Ttn C A 2: 76,739,158 K27130N probably damaging Het
Ttn C T 2: 76,907,752 V4148I probably benign Het
Ugcg T C 4: 59,213,931 L171P possibly damaging Het
Vsig2 T C 9: 37,542,576 probably benign Het
Zcchc11 T A 4: 108,530,955 probably benign Het
Zfp839 T A 12: 110,868,386 S692T possibly damaging Het
Other mutations in Uba7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Uba7 APN 9 107979111 missense probably benign 0.31
IGL01696:Uba7 APN 9 107977348 missense probably damaging 1.00
IGL02137:Uba7 APN 9 107979753 splice site probably benign
IGL02272:Uba7 APN 9 107976153 missense probably benign 0.01
IGL02287:Uba7 APN 9 107978227 missense probably benign 0.10
IGL02430:Uba7 APN 9 107979468 splice site probably benign
IGL02552:Uba7 APN 9 107981390 missense probably benign 0.00
IGL02820:Uba7 APN 9 107981516 missense probably benign 0.01
IGL03234:Uba7 APN 9 107976400 missense probably damaging 0.97
R0013:Uba7 UTSW 9 107978249 missense probably damaging 1.00
R0717:Uba7 UTSW 9 107977217 missense probably benign 0.44
R2108:Uba7 UTSW 9 107979288 missense probably benign
R2253:Uba7 UTSW 9 107976364 missense probably benign 0.26
R4239:Uba7 UTSW 9 107976802 critical splice donor site probably null
R4528:Uba7 UTSW 9 107983903 missense possibly damaging 0.79
R4735:Uba7 UTSW 9 107976916 missense possibly damaging 0.94
R4736:Uba7 UTSW 9 107980165 missense probably benign 0.00
R4751:Uba7 UTSW 9 107979805 missense possibly damaging 0.66
R4937:Uba7 UTSW 9 107978991 missense possibly damaging 0.95
R4999:Uba7 UTSW 9 107979839 critical splice donor site probably null
R5020:Uba7 UTSW 9 107978914 missense probably benign
R5157:Uba7 UTSW 9 107980047 missense probably benign 0.04
R5214:Uba7 UTSW 9 107977514 intron probably benign
R5339:Uba7 UTSW 9 107978866 missense probably damaging 1.00
R5990:Uba7 UTSW 9 107981234 missense probably damaging 0.96
R6092:Uba7 UTSW 9 107983160 missense possibly damaging 0.96
R6110:Uba7 UTSW 9 107978939 missense probably benign 0.25
R6363:Uba7 UTSW 9 107980183 critical splice donor site probably null
R6495:Uba7 UTSW 9 107977014 nonsense probably null
R6644:Uba7 UTSW 9 107981472 missense possibly damaging 0.55
R7032:Uba7 UTSW 9 107976172 missense possibly damaging 0.83
R7095:Uba7 UTSW 9 107983339 missense probably benign 0.01
R7517:Uba7 UTSW 9 107976698 splice site probably benign
X0024:Uba7 UTSW 9 107975945 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGAGGTCCTAAAGGTAGGCAC -3'
(R):5'- CACAGCAATTTGCCCATCGTATCG -3'

Sequencing Primer
(F):5'- CAGGTAGTGTGTGTGCCAGAG -3'
(R):5'- CACAGATAATGGCCTGTGCTATG -3'
Posted On2013-05-09