Mutagenetix > Incidental Mutation

Incidental Mutation 'R4394:Trip12'

326508

Institutional Source

Beutler Lab

Gene Symbol

Trip12

Ensembl Gene

ENSMUSG00000026219

Gene Name

thyroid hormone receptor interactor 12

Synonyms

6720416K24Rik, 1110036I07Rik, Gtl6

MMRRC Submission

041683-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4394 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84721189-84840516 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 84725741 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 729 (H729Q)

Ref Sequence

ENSEMBL: ENSMUSP00000140789 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027421] [ENSMUST00000186465] [ENSMUST00000186648] [ENSMUST00000187733] [ENSMUST00000189670]

AlphaFold

G5E870

Predicted Effect

probably damaging
Transcript: ENSMUST00000027421
AA Change: H1924Q

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000027421
Gene: ENSMUSG00000026219
AA Change: H1924Q

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	5e-20	SMART
PDB:1WA5\|B	447	641	1e-5	PDB
Pfam:WWE	765	831	7.6e-22	PFAM
low complexity region	983	1006	N/A	INTRINSIC
low complexity region	1033	1047	N/A	INTRINSIC
low complexity region	1062	1073	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	1345	1362	N/A	INTRINSIC
Blast:HECTc	1363	1417	8e-8	BLAST
Blast:HECTc	1573	1629	2e-24	BLAST
HECTc	1636	2025	1.29e-177	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185720

Predicted Effect

probably damaging
Transcript: ENSMUST00000186465
AA Change: H1924Q

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000140224
Gene: ENSMUSG00000026219
AA Change: H1924Q

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	5e-20	SMART
PDB:1WA5\|B	447	641	1e-5	PDB
Pfam:WWE	761	831	2.2e-22	PFAM
low complexity region	983	1006	N/A	INTRINSIC
low complexity region	1033	1047	N/A	INTRINSIC
low complexity region	1062	1073	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	1345	1362	N/A	INTRINSIC
Blast:HECTc	1363	1417	8e-8	BLAST
Blast:HECTc	1573	1629	2e-24	BLAST
HECTc	1636	2025	1.29e-177	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000186648
AA Change: H1891Q

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000139563
Gene: ENSMUSG00000026219
AA Change: H1891Q

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	386	400	N/A	INTRINSIC
low complexity region	410	421	N/A	INTRINSIC
SCOP:d1ee4a_	440	654	5e-20	SMART
PDB:1WA5\|B	441	635	1e-5	PDB
low complexity region	950	973	N/A	INTRINSIC
low complexity region	1000	1014	N/A	INTRINSIC
low complexity region	1029	1040	N/A	INTRINSIC
low complexity region	1300	1311	N/A	INTRINSIC
low complexity region	1312	1329	N/A	INTRINSIC
Blast:HECTc	1330	1384	7e-8	BLAST
Blast:HECTc	1540	1596	2e-24	BLAST
HECTc	1603	1992	6.2e-180	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000187733

Predicted Effect

probably damaging
Transcript: ENSMUST00000189670
AA Change: H729Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000140789
Gene: ENSMUSG00000026219
AA Change: H729Q

Domain	Start	End	E-Value	Type
low complexity region	138	149	N/A	INTRINSIC
low complexity region	150	167	N/A	INTRINSIC
Blast:HECTc	168	222	5e-8	BLAST
Blast:HECTc	378	434	1e-24	BLAST
HECTc	441	830	6.2e-180	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191187

Meta Mutation Damage Score

0.0834

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 96.8%
20x: 93.4%

Validation Efficiency

99% (69/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase involved in the degradation of the p19ARF/ARF isoform of CDKN2A, a tumor suppressor. The encoded protein also plays a role in the DNA damage response by regulating the stability of USP7, which regulates tumor suppressor p53. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit complete embryonic lethality during organogenesis associated with embryonic growth retardation and abnormal placenta development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abtb1	A	G	6: 88,836,584	F391L	probably damaging	Het
AC140205.10	C	A	8: 20,833,165	T192K	probably benign	Het
Arid4b	T	A	13: 14,154,972		probably null	Het
Bahd1	G	A	2: 118,922,523	R757H	probably damaging	Het
Brip1	A	T	11: 86,074,298	N855K	possibly damaging	Het
Ces2f	A	G	8: 104,950,954	N197S	probably damaging	Het
Chd4	A	G	6: 125,121,618	T1520A	probably damaging	Het
Cltc	A	C	11: 86,733,630	N159K	probably damaging	Het
Cntn1	C	T	15: 92,291,764	T656I	probably damaging	Het
Crybg3	A	G	16: 59,560,095		probably benign	Het
Dzip1l	T	A	9: 99,639,854	L181H	probably damaging	Het
Fam3b	C	A	16: 97,481,786		probably null	Het
Fat1	T	A	8: 44,952,346	N711K	probably damaging	Het
Fat3	A	G	9: 15,922,792	I4168T	probably benign	Het
Fbxw20	T	C	9: 109,232,330	D117G	probably benign	Het
Gm8122	A	G	14: 43,234,068	L81P	unknown	Het
Hal	T	C	10: 93,496,559		probably benign	Het
Hgf	T	A	5: 16,618,951	Y715*	probably null	Het
Hid1	T	A	11: 115,367,642		probably benign	Het
Hyou1	T	A	9: 44,381,872	V125E	probably damaging	Het
Jrkl	G	A	9: 13,245,141	Q172*	probably null	Het
Lamc3	A	G	2: 31,931,952	E1304G	probably benign	Het
Lman2l	A	C	1: 36,439,723	C103G	probably damaging	Het
Lrfn5	T	C	12: 61,843,490	S522P	probably damaging	Het
Mark3	A	T	12: 111,604,523	I86L	possibly damaging	Het
Mfsd13a	C	T	19: 46,371,992	R328C	probably damaging	Het
Mgst2	G	A	3: 51,664,528	V26I	probably damaging	Het
Neb	A	T	2: 52,187,513	Y158*	probably null	Het
Nipbl	T	C	15: 8,361,861	I210V	probably benign	Het
Olfr1057	C	T	2: 86,375,179	A78T	possibly damaging	Het
Olfr830	A	T	9: 18,875,611	I95L	probably damaging	Het
Pcdhb8	C	T	18: 37,356,882	P538S	probably damaging	Het
Postn	A	G	3: 54,370,955	D295G	probably damaging	Het
Prss38	T	C	11: 59,373,028	Y286C	probably damaging	Het
Psen2	A	T	1: 180,240,782	V102E	probably damaging	Het
Ptpn9	A	T	9: 57,036,563	K126N	possibly damaging	Het
Ptprd	A	G	4: 76,128,685	I435T	probably damaging	Het
Rab39	T	C	9: 53,686,650	K105R	probably benign	Het
Robo2	C	A	16: 73,948,379	R840L	probably benign	Het
Rps6ka5	T	A	12: 100,581,319	I311F	probably damaging	Het
Ryr1	G	T	7: 29,094,242	T1267K	possibly damaging	Het
Sis	G	A	3: 72,956,149	T252I	probably damaging	Het
Slc41a3	A	T	6: 90,635,330	S201C	probably damaging	Het
Slitrk1	A	C	14: 108,911,303	S659A	probably benign	Het
Snx25	A	T	8: 46,035,678	M880K	probably damaging	Het
Tbxas1	C	T	6: 39,027,779	T320I	probably benign	Het
Tex44	T	C	1: 86,427,767	V466A	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Tnxb	C	T	17: 34,678,662	Q804*	probably null	Het
Tpst1	T	A	5: 130,102,502	M271K	probably benign	Het
Trank1	C	T	9: 111,365,197	T763I	possibly damaging	Het
Tshz3	A	T	7: 36,769,605	T340S	probably damaging	Het
Ttc5	T	C	14: 50,781,505	K52E	probably benign	Het
Ugt1a1	CAGAGAGAGAGAGA	CAGAGAGAGAGA	1: 88,211,984		probably benign	Het
Vmn2r79	A	G	7: 87,001,891	H166R	possibly damaging	Het
Wsb2	T	G	5: 117,363,578		probably benign	Het

Other mutations in Trip12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00331:Trip12	APN	1	84730541	missense	probably damaging	1.00
IGL00430:Trip12	APN	1	84763861	missense	probably damaging	0.96
IGL00465:Trip12	APN	1	84763861	missense	probably damaging	0.96
IGL00819:Trip12	APN	1	84754272	missense	probably damaging	1.00
IGL00900:Trip12	APN	1	84724764	missense	possibly damaging	0.56
IGL00990:Trip12	APN	1	84751884	missense	probably damaging	0.99
IGL01087:Trip12	APN	1	84757859	missense	probably damaging	0.99
IGL01400:Trip12	APN	1	84751978	missense	probably damaging	0.99
IGL01521:Trip12	APN	1	84766198	splice site	probably benign
IGL01619:Trip12	APN	1	84814910	missense	probably damaging	0.99
IGL01796:Trip12	APN	1	84728278	missense	probably benign	0.42
IGL01975:Trip12	APN	1	84814813	splice site	probably benign
IGL02190:Trip12	APN	1	84766070	missense	probably damaging	0.98
IGL02474:Trip12	APN	1	84794133	missense	probably benign
IGL02517:Trip12	APN	1	84743814	unclassified	probably benign
IGL02631:Trip12	APN	1	84766008	missense	possibly damaging	0.91
IGL02991:Trip12	APN	1	84738815	missense	probably damaging	1.00
IGL03161:Trip12	APN	1	84761132	unclassified	probably benign
IGL03388:Trip12	APN	1	84743186	missense	probably damaging	0.99
cardamom	UTSW	1	84749276	missense	probably damaging	0.99
pungent	UTSW	1	84793915	missense	possibly damaging	0.70
spices	UTSW	1	84793875	missense	probably benign	0.10
sulfuric	UTSW	1	84759050	missense	probably benign	0.19
Turmeric	UTSW	1	84754343	missense	probably benign	0.07
LCD18:Trip12	UTSW	1	84754482	unclassified	probably benign
R0090:Trip12	UTSW	1	84732136	splice site	probably benign
R0111:Trip12	UTSW	1	84759133	unclassified	probably benign
R0471:Trip12	UTSW	1	84726207	missense	probably damaging	1.00
R0486:Trip12	UTSW	1	84761084	nonsense	probably null
R0557:Trip12	UTSW	1	84724747	missense	probably damaging	1.00
R0570:Trip12	UTSW	1	84751548	missense	probably damaging	1.00
R0614:Trip12	UTSW	1	84757761	missense	probably damaging	1.00
R0627:Trip12	UTSW	1	84768597	missense	probably damaging	1.00
R0630:Trip12	UTSW	1	84793915	missense	possibly damaging	0.70
R0657:Trip12	UTSW	1	84759050	missense	probably benign	0.19
R0741:Trip12	UTSW	1	84745181	missense	probably benign	0.09
R0862:Trip12	UTSW	1	84744009	missense	probably damaging	0.99
R0864:Trip12	UTSW	1	84744009	missense	probably damaging	0.99
R1124:Trip12	UTSW	1	84737037	missense	probably damaging	1.00
R1252:Trip12	UTSW	1	84776350	nonsense	probably null
R1455:Trip12	UTSW	1	84759100	missense	probably benign	0.01
R1487:Trip12	UTSW	1	84768631	missense	probably damaging	1.00
R1702:Trip12	UTSW	1	84745063	missense	probably damaging	1.00
R1781:Trip12	UTSW	1	84730621	missense	probably benign	0.01
R1847:Trip12	UTSW	1	84749269	missense	probably damaging	1.00
R1854:Trip12	UTSW	1	84728145	missense	probably damaging	1.00
R1866:Trip12	UTSW	1	84745060	missense	probably damaging	1.00
R1926:Trip12	UTSW	1	84749291	missense	probably damaging	0.98
R1935:Trip12	UTSW	1	84794101	missense	possibly damaging	0.46
R1950:Trip12	UTSW	1	84760801	missense	probably damaging	1.00
R1994:Trip12	UTSW	1	84749172	missense	probably damaging	1.00
R2014:Trip12	UTSW	1	84760866	nonsense	probably null
R2391:Trip12	UTSW	1	84814790	frame shift	probably null
R2423:Trip12	UTSW	1	84814790	frame shift	probably null
R2433:Trip12	UTSW	1	84743823	missense	possibly damaging	0.84
R2905:Trip12	UTSW	1	84754343	missense	probably benign	0.07
R3040:Trip12	UTSW	1	84742245	missense	probably benign	0.13
R3735:Trip12	UTSW	1	84814790	frame shift	probably null
R3907:Trip12	UTSW	1	84732106	missense	possibly damaging	0.53
R4540:Trip12	UTSW	1	84749276	missense	probably damaging	0.99
R4859:Trip12	UTSW	1	84793810	missense	probably damaging	0.99
R5240:Trip12	UTSW	1	84794133	missense	probably benign
R5278:Trip12	UTSW	1	84762147	missense	probably damaging	1.00
R5377:Trip12	UTSW	1	84757431	missense	probably damaging	1.00
R5510:Trip12	UTSW	1	84768680	missense	probably damaging	1.00
R5542:Trip12	UTSW	1	84749344	missense	probably damaging	1.00
R5550:Trip12	UTSW	1	84761099	missense	probably damaging	0.99
R5886:Trip12	UTSW	1	84730458	intron	probably benign
R5893:Trip12	UTSW	1	84759163	unclassified	probably benign
R5914:Trip12	UTSW	1	84763458	missense	probably damaging	1.00
R5925:Trip12	UTSW	1	84749253	nonsense	probably null
R5985:Trip12	UTSW	1	84725771	missense	probably damaging	0.99
R6135:Trip12	UTSW	1	84760838	missense	probably benign	0.00
R6158:Trip12	UTSW	1	84761012	missense	possibly damaging	0.84
R6419:Trip12	UTSW	1	84793870	missense	probably damaging	1.00
R6816:Trip12	UTSW	1	84793714	missense	probably damaging	0.99
R7144:Trip12	UTSW	1	84793714	missense	probably damaging	0.99
R7194:Trip12	UTSW	1	84794222	missense	probably benign	0.07
R7355:Trip12	UTSW	1	84814883	missense	probably damaging	1.00
R7361:Trip12	UTSW	1	84750442	missense	probably damaging	0.98
R7588:Trip12	UTSW	1	84760883	missense	probably damaging	0.99
R7705:Trip12	UTSW	1	84777449	missense	probably damaging	1.00
R7818:Trip12	UTSW	1	84760806	missense	probably damaging	1.00
R7918:Trip12	UTSW	1	84745063	missense	probably damaging	0.98
R8127:Trip12	UTSW	1	84738742	missense	probably damaging	0.99
R8221:Trip12	UTSW	1	84766050	missense	possibly damaging	0.80
R8336:Trip12	UTSW	1	84766041	missense	probably benign	0.37
R8373:Trip12	UTSW	1	84795767	missense	probably damaging	0.98
R8719:Trip12	UTSW	1	84745069	missense	probably damaging	0.98
R8771:Trip12	UTSW	1	84743297	unclassified	probably benign
R8997:Trip12	UTSW	1	84793875	missense	probably benign	0.10
R9146:Trip12	UTSW	1	84794160	missense	possibly damaging	0.89
R9236:Trip12	UTSW	1	84725829	missense	probably damaging	1.00
R9338:Trip12	UTSW	1	84749298	missense	probably damaging	0.99
R9391:Trip12	UTSW	1	84795752	missense	probably benign	0.00
R9516:Trip12	UTSW	1	84757494	missense	probably damaging	1.00
X0023:Trip12	UTSW	1	84760787	missense	probably benign	0.12
X0065:Trip12	UTSW	1	84749163	missense	probably benign	0.21
Z1088:Trip12	UTSW	1	84766168	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTTTGCGTTAAGATGGAACTG -3'
(R):5'- GCACACTGGAAGCCATGTTC -3'

Sequencing Primer
(F):5'- ACCAAACCTCACTTATAATCATGATG -3'
(R):5'- GCCATGTTCTTAGAGAGACAGCTAC -3'

Posted On

2015-07-06