Incidental Mutation 'R4394:Sis'
ID326518
Institutional Source Beutler Lab
Gene Symbol Sis
Ensembl Gene ENSMUSG00000027790
Gene Namesucrase isomaltase (alpha-glucosidase)
SynonymsSi-s, sucrase-isomaltase
MMRRC Submission 041683-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4394 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location72888557-72967863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 72956149 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 252 (T252I)
Ref Sequence ENSEMBL: ENSMUSP00000129116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094190] [ENSMUST00000167334]
Predicted Effect probably damaging
Transcript: ENSMUST00000094190
AA Change: T252I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091742
Gene: ENSMUSG00000027790
AA Change: T252I

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
PD 51 103 1.92e-12 SMART
Pfam:NtCtMGAM_N 115 224 1.2e-35 PFAM
Pfam:Gal_mutarotas_2 225 294 4.8e-9 PFAM
Pfam:Glyco_hydro_31 314 787 2.1e-142 PFAM
PD 917 972 6.69e-12 SMART
Pfam:NtCtMGAM_N 985 1098 6e-33 PFAM
Blast:ANK 1138 1168 1e-5 BLAST
Pfam:Glyco_hydro_31 1186 1682 8.4e-137 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167334
AA Change: T252I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129116
Gene: ENSMUSG00000027790
AA Change: T252I

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
PD 51 103 1.92e-12 SMART
Pfam:NtCtMGAM_N 115 224 1.2e-35 PFAM
Pfam:Gal_mutarotas_2 225 294 4.8e-9 PFAM
Pfam:Glyco_hydro_31 314 787 2.1e-142 PFAM
PD 917 972 6.69e-12 SMART
Pfam:NtCtMGAM_N 985 1098 6e-33 PFAM
Blast:ANK 1138 1168 1e-5 BLAST
Pfam:Glyco_hydro_31 1186 1682 8.4e-137 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191870
Meta Mutation Damage Score 0.3335 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sucrase-isomaltase enzyme that is expressed in the intestinal brush border. The encoded protein is synthesized as a precursor protein that is cleaved by pancreatic proteases into two enzymatic subunits sucrase and isomaltase. These two subunits heterodimerize to form the sucrose-isomaltase complex. This complex is essential for the digestion of dietary carbohydrates including starch, sucrose and isomaltose. Mutations in this gene are the cause of congenital sucrase-isomaltase deficiency.[provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A G 6: 88,836,584 F391L probably damaging Het
AC140205.10 C A 8: 20,833,165 T192K probably benign Het
Arid4b T A 13: 14,154,972 probably null Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Brip1 A T 11: 86,074,298 N855K possibly damaging Het
Ces2f A G 8: 104,950,954 N197S probably damaging Het
Chd4 A G 6: 125,121,618 T1520A probably damaging Het
Cltc A C 11: 86,733,630 N159K probably damaging Het
Cntn1 C T 15: 92,291,764 T656I probably damaging Het
Crybg3 A G 16: 59,560,095 probably benign Het
Dzip1l T A 9: 99,639,854 L181H probably damaging Het
Fam3b C A 16: 97,481,786 probably null Het
Fat1 T A 8: 44,952,346 N711K probably damaging Het
Fat3 A G 9: 15,922,792 I4168T probably benign Het
Fbxw20 T C 9: 109,232,330 D117G probably benign Het
Gm8122 A G 14: 43,234,068 L81P unknown Het
Hal T C 10: 93,496,559 probably benign Het
Hgf T A 5: 16,618,951 Y715* probably null Het
Hid1 T A 11: 115,367,642 probably benign Het
Hyou1 T A 9: 44,381,872 V125E probably damaging Het
Jrkl G A 9: 13,245,141 Q172* probably null Het
Lamc3 A G 2: 31,931,952 E1304G probably benign Het
Lman2l A C 1: 36,439,723 C103G probably damaging Het
Lrfn5 T C 12: 61,843,490 S522P probably damaging Het
Mark3 A T 12: 111,604,523 I86L possibly damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mgst2 G A 3: 51,664,528 V26I probably damaging Het
Neb A T 2: 52,187,513 Y158* probably null Het
Nipbl T C 15: 8,361,861 I210V probably benign Het
Olfr1057 C T 2: 86,375,179 A78T possibly damaging Het
Olfr830 A T 9: 18,875,611 I95L probably damaging Het
Pcdhb8 C T 18: 37,356,882 P538S probably damaging Het
Postn A G 3: 54,370,955 D295G probably damaging Het
Prss38 T C 11: 59,373,028 Y286C probably damaging Het
Psen2 A T 1: 180,240,782 V102E probably damaging Het
Ptpn9 A T 9: 57,036,563 K126N possibly damaging Het
Ptprd A G 4: 76,128,685 I435T probably damaging Het
Rab39 T C 9: 53,686,650 K105R probably benign Het
Robo2 C A 16: 73,948,379 R840L probably benign Het
Rps6ka5 T A 12: 100,581,319 I311F probably damaging Het
Ryr1 G T 7: 29,094,242 T1267K possibly damaging Het
Slc41a3 A T 6: 90,635,330 S201C probably damaging Het
Slitrk1 A C 14: 108,911,303 S659A probably benign Het
Snx25 A T 8: 46,035,678 M880K probably damaging Het
Tbxas1 C T 6: 39,027,779 T320I probably benign Het
Tex44 T C 1: 86,427,767 V466A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tnxb C T 17: 34,678,662 Q804* probably null Het
Tpst1 T A 5: 130,102,502 M271K probably benign Het
Trank1 C T 9: 111,365,197 T763I possibly damaging Het
Trip12 A T 1: 84,725,741 H729Q probably damaging Het
Tshz3 A T 7: 36,769,605 T340S probably damaging Het
Ttc5 T C 14: 50,781,505 K52E probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Wsb2 T G 5: 117,363,578 probably benign Het
Other mutations in Sis
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Sis APN 3 72946636 missense probably benign
IGL00715:Sis APN 3 72934124 missense probably damaging 1.00
IGL00721:Sis APN 3 72943579 missense probably damaging 1.00
IGL00766:Sis APN 3 72907237 splice site probably benign
IGL00783:Sis APN 3 72946632 missense probably benign
IGL00805:Sis APN 3 72934199 missense probably benign 0.05
IGL00932:Sis APN 3 72940956 splice site probably benign
IGL01020:Sis APN 3 72966838 missense probably damaging 1.00
IGL01024:Sis APN 3 72911876 missense probably damaging 1.00
IGL01286:Sis APN 3 72941025 missense probably damaging 1.00
IGL01457:Sis APN 3 72961021 missense probably benign
IGL01514:Sis APN 3 72935920 splice site probably benign
IGL01986:Sis APN 3 72945212 missense probably damaging 1.00
IGL02110:Sis APN 3 72928699 nonsense probably null
IGL02132:Sis APN 3 72947471 missense probably benign 0.00
IGL02152:Sis APN 3 72888986 utr 3 prime probably benign
IGL02200:Sis APN 3 72943604 missense probably damaging 0.99
IGL02244:Sis APN 3 72956190 missense probably benign 0.19
IGL02307:Sis APN 3 72911834 splice site probably benign
IGL02374:Sis APN 3 72925456 missense probably benign 0.03
IGL02437:Sis APN 3 72919614 critical splice acceptor site probably null
IGL02571:Sis APN 3 72956304 splice site probably benign
IGL02601:Sis APN 3 72913210 missense probably benign 0.44
IGL03063:Sis APN 3 72928297 missense probably benign
IGL03382:Sis APN 3 72928719 missense probably benign 0.00
IGL03397:Sis APN 3 72935879 missense probably benign 0.44
PIT1430001:Sis UTSW 3 72922829 missense probably damaging 0.97
R0013:Sis UTSW 3 72910476 missense possibly damaging 0.65
R0013:Sis UTSW 3 72910476 missense possibly damaging 0.65
R0046:Sis UTSW 3 72932094 missense probably benign 0.01
R0094:Sis UTSW 3 72921437 missense probably damaging 1.00
R0096:Sis UTSW 3 72928267 missense probably damaging 1.00
R0505:Sis UTSW 3 72960296 missense probably benign 0.29
R0544:Sis UTSW 3 72951642 missense probably damaging 1.00
R0551:Sis UTSW 3 72925407 missense possibly damaging 0.79
R0617:Sis UTSW 3 72965605 missense probably damaging 1.00
R0698:Sis UTSW 3 72910498 missense probably damaging 1.00
R0701:Sis UTSW 3 72941045 missense probably damaging 1.00
R0704:Sis UTSW 3 72949822 missense possibly damaging 0.63
R0706:Sis UTSW 3 72952531 missense probably damaging 1.00
R0710:Sis UTSW 3 72952531 missense probably damaging 1.00
R0752:Sis UTSW 3 72952531 missense probably damaging 1.00
R0753:Sis UTSW 3 72952531 missense probably damaging 1.00
R0754:Sis UTSW 3 72952531 missense probably damaging 1.00
R0767:Sis UTSW 3 72952531 missense probably damaging 1.00
R0769:Sis UTSW 3 72952531 missense probably damaging 1.00
R0772:Sis UTSW 3 72952531 missense probably damaging 1.00
R0774:Sis UTSW 3 72952531 missense probably damaging 1.00
R0776:Sis UTSW 3 72952531 missense probably damaging 1.00
R0818:Sis UTSW 3 72952531 missense probably damaging 1.00
R0819:Sis UTSW 3 72952531 missense probably damaging 1.00
R0885:Sis UTSW 3 72911949 nonsense probably null
R1076:Sis UTSW 3 72934098 missense probably damaging 0.97
R1140:Sis UTSW 3 72951616 missense probably damaging 0.98
R1175:Sis UTSW 3 72958104 splice site probably benign
R1301:Sis UTSW 3 72946582 missense possibly damaging 0.76
R1437:Sis UTSW 3 72934142 missense probably damaging 1.00
R1466:Sis UTSW 3 72932060 missense possibly damaging 0.60
R1466:Sis UTSW 3 72932060 missense possibly damaging 0.60
R1472:Sis UTSW 3 72889027 missense probably benign 0.12
R1584:Sis UTSW 3 72932060 missense possibly damaging 0.60
R1707:Sis UTSW 3 72909087 splice site probably benign
R1715:Sis UTSW 3 72889010 missense possibly damaging 0.47
R1719:Sis UTSW 3 72965604 missense probably damaging 1.00
R1728:Sis UTSW 3 72965645 nonsense probably null
R1784:Sis UTSW 3 72965645 nonsense probably null
R1820:Sis UTSW 3 72921142 missense probably damaging 1.00
R1972:Sis UTSW 3 72921004 missense probably damaging 1.00
R1973:Sis UTSW 3 72921004 missense probably damaging 1.00
R2054:Sis UTSW 3 72913237 missense probably benign 0.01
R2233:Sis UTSW 3 72913194 missense probably benign 0.03
R2235:Sis UTSW 3 72913194 missense probably benign 0.03
R2276:Sis UTSW 3 72914601 nonsense probably null
R2435:Sis UTSW 3 72911904 missense probably benign 0.01
R2885:Sis UTSW 3 72909173 missense probably benign 0.01
R2966:Sis UTSW 3 72889010 missense probably benign 0.30
R3708:Sis UTSW 3 72943523 missense probably benign 0.02
R3790:Sis UTSW 3 72921414 missense probably damaging 1.00
R3807:Sis UTSW 3 72925596 missense probably benign 0.01
R3858:Sis UTSW 3 72928652 missense probably damaging 0.99
R3974:Sis UTSW 3 72943635 missense probably damaging 0.96
R3975:Sis UTSW 3 72943635 missense probably damaging 0.96
R4037:Sis UTSW 3 72928602 missense probably benign
R4080:Sis UTSW 3 72921184 missense probably damaging 1.00
R4204:Sis UTSW 3 72961082 missense probably benign
R4470:Sis UTSW 3 72928159 splice site probably null
R4573:Sis UTSW 3 72928237 missense possibly damaging 0.94
R4868:Sis UTSW 3 72943548 missense probably benign 0.09
R5023:Sis UTSW 3 72934122 missense probably benign 0.05
R5264:Sis UTSW 3 72949756 missense probably damaging 0.98
R5414:Sis UTSW 3 72952493 missense probably benign
R5462:Sis UTSW 3 72949838 missense probably damaging 0.96
R5523:Sis UTSW 3 72891421 missense probably benign 0.00
R5584:Sis UTSW 3 72910415 missense probably damaging 1.00
R5587:Sis UTSW 3 72914576 missense possibly damaging 0.94
R5725:Sis UTSW 3 72965598 missense probably damaging 1.00
R5769:Sis UTSW 3 72928235 missense probably damaging 0.98
R5790:Sis UTSW 3 72928174 missense probably benign
R5864:Sis UTSW 3 72949818 missense probably damaging 1.00
R5902:Sis UTSW 3 72960256 critical splice donor site probably null
R5925:Sis UTSW 3 72921380 splice site probably null
R6018:Sis UTSW 3 72913192 missense possibly damaging 0.95
R6029:Sis UTSW 3 72928308 missense probably benign 0.30
R6124:Sis UTSW 3 72953211 missense possibly damaging 0.69
R6171:Sis UTSW 3 72961027 missense possibly damaging 0.75
R6182:Sis UTSW 3 72904293 missense probably benign 0.05
R6295:Sis UTSW 3 72966770 missense probably damaging 0.99
R6416:Sis UTSW 3 72911854 missense probably damaging 1.00
R6431:Sis UTSW 3 72958174 missense probably benign 0.00
R6472:Sis UTSW 3 72938734 nonsense probably null
R6517:Sis UTSW 3 72907142 missense probably damaging 1.00
R6701:Sis UTSW 3 72949527 missense probably damaging 1.00
R6796:Sis UTSW 3 72965618 missense probably benign 0.06
R6853:Sis UTSW 3 72891426 missense possibly damaging 0.93
R6906:Sis UTSW 3 72919485 missense probably damaging 1.00
R7058:Sis UTSW 3 72903607 missense probably damaging 0.98
R7357:Sis UTSW 3 72925071 missense probably damaging 1.00
R7381:Sis UTSW 3 72913292 splice site probably null
R7439:Sis UTSW 3 72909041 missense possibly damaging 0.81
R7742:Sis UTSW 3 72925098 missense probably benign 0.19
R7813:Sis UTSW 3 72925468 missense probably benign 0.01
R7883:Sis UTSW 3 72920996 missense possibly damaging 0.78
R7899:Sis UTSW 3 72937251 missense probably damaging 1.00
R7915:Sis UTSW 3 72921138 missense probably damaging 0.99
R8020:Sis UTSW 3 72908965 critical splice donor site probably null
R8023:Sis UTSW 3 72952480 missense probably damaging 0.97
R8029:Sis UTSW 3 72921142 missense probably damaging 1.00
R8053:Sis UTSW 3 72949568 nonsense probably null
R8062:Sis UTSW 3 72920988 nonsense probably null
R8074:Sis UTSW 3 72917198 missense probably damaging 1.00
R8085:Sis UTSW 3 72907129 missense probably damaging 1.00
R8137:Sis UTSW 3 72889045 missense probably benign 0.22
R8349:Sis UTSW 3 72903651 missense probably damaging 1.00
R8354:Sis UTSW 3 72947501 missense possibly damaging 0.84
R8366:Sis UTSW 3 72958233 missense probably damaging 1.00
R8449:Sis UTSW 3 72903651 missense probably damaging 1.00
R8454:Sis UTSW 3 72947501 missense possibly damaging 0.84
R8515:Sis UTSW 3 72929409 missense probably benign 0.00
X0009:Sis UTSW 3 72889022 missense probably damaging 0.99
X0024:Sis UTSW 3 72928670 missense probably benign
X0060:Sis UTSW 3 72920906 intron probably benign
Z1176:Sis UTSW 3 72904273 missense probably benign 0.05
Z1176:Sis UTSW 3 72943557 missense probably benign 0.25
Z1177:Sis UTSW 3 72909172 missense possibly damaging 0.88
Z1177:Sis UTSW 3 72910474 missense probably damaging 1.00
Z1177:Sis UTSW 3 72943569 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTAGAAAGGTGTAGGAGGATCAACC -3'
(R):5'- TCTCCCATTCACGACTGCAG -3'

Sequencing Primer
(F):5'- TGTAGGAGGATCAACCGGAAC -3'
(R):5'- TTCACGACTGCAGCACTTAAG -3'
Posted On2015-07-06