Incidental Mutation 'R4394:Abtb1'
ID326525
Institutional Source Beutler Lab
Gene Symbol Abtb1
Ensembl Gene ENSMUSG00000030083
Gene Nameankyrin repeat and BTB (POZ) domain containing 1
SynonymsBPOZ, EF1ABP
MMRRC Submission 041683-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R4394 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location88835914-88841984 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88836584 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 391 (F391L)
Ref Sequence ENSEMBL: ENSMUSP00000032169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032169] [ENSMUST00000203137] [ENSMUST00000203272] [ENSMUST00000203864] [ENSMUST00000204327] [ENSMUST00000204458] [ENSMUST00000204932] [ENSMUST00000205082]
Predicted Effect probably damaging
Transcript: ENSMUST00000032169
AA Change: F391L

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032169
Gene: ENSMUSG00000030083
AA Change: F391L

DomainStartEndE-ValueType
ANK 1 31 5.03e2 SMART
ANK 35 64 2.81e-4 SMART
BTB 115 212 7.8e-18 SMART
BTB 272 376 4.24e-19 SMART
low complexity region 412 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203120
Predicted Effect probably benign
Transcript: ENSMUST00000203137
Predicted Effect probably benign
Transcript: ENSMUST00000203272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203514
Predicted Effect probably benign
Transcript: ENSMUST00000203864
Predicted Effect probably benign
Transcript: ENSMUST00000204327
Predicted Effect probably benign
Transcript: ENSMUST00000204458
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204560
Predicted Effect probably benign
Transcript: ENSMUST00000204932
Predicted Effect probably benign
Transcript: ENSMUST00000205082
Meta Mutation Damage Score 0.3776 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with an ankyrin repeat region and two BTB/POZ domains, which are thought to be involved in protein-protein interactions. Expression of this gene is activated by the phosphatase and tensin homolog, a tumor suppressor. Alternate splicing results in three transcript variants. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AC140205.10 C A 8: 20,833,165 T192K probably benign Het
Arid4b T A 13: 14,154,972 probably null Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Brip1 A T 11: 86,074,298 N855K possibly damaging Het
Ces2f A G 8: 104,950,954 N197S probably damaging Het
Chd4 A G 6: 125,121,618 T1520A probably damaging Het
Cltc A C 11: 86,733,630 N159K probably damaging Het
Cntn1 C T 15: 92,291,764 T656I probably damaging Het
Crybg3 A G 16: 59,560,095 probably benign Het
Dzip1l T A 9: 99,639,854 L181H probably damaging Het
Fam3b C A 16: 97,481,786 probably null Het
Fat1 T A 8: 44,952,346 N711K probably damaging Het
Fat3 A G 9: 15,922,792 I4168T probably benign Het
Fbxw20 T C 9: 109,232,330 D117G probably benign Het
Gm8122 A G 14: 43,234,068 L81P unknown Het
Hal T C 10: 93,496,559 probably benign Het
Hgf T A 5: 16,618,951 Y715* probably null Het
Hid1 T A 11: 115,367,642 probably benign Het
Hyou1 T A 9: 44,381,872 V125E probably damaging Het
Jrkl G A 9: 13,245,141 Q172* probably null Het
Lamc3 A G 2: 31,931,952 E1304G probably benign Het
Lman2l A C 1: 36,439,723 C103G probably damaging Het
Lrfn5 T C 12: 61,843,490 S522P probably damaging Het
Mark3 A T 12: 111,604,523 I86L possibly damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mgst2 G A 3: 51,664,528 V26I probably damaging Het
Neb A T 2: 52,187,513 Y158* probably null Het
Nipbl T C 15: 8,361,861 I210V probably benign Het
Olfr1057 C T 2: 86,375,179 A78T possibly damaging Het
Olfr830 A T 9: 18,875,611 I95L probably damaging Het
Pcdhb8 C T 18: 37,356,882 P538S probably damaging Het
Postn A G 3: 54,370,955 D295G probably damaging Het
Prss38 T C 11: 59,373,028 Y286C probably damaging Het
Psen2 A T 1: 180,240,782 V102E probably damaging Het
Ptpn9 A T 9: 57,036,563 K126N possibly damaging Het
Ptprd A G 4: 76,128,685 I435T probably damaging Het
Rab39 T C 9: 53,686,650 K105R probably benign Het
Robo2 C A 16: 73,948,379 R840L probably benign Het
Rps6ka5 T A 12: 100,581,319 I311F probably damaging Het
Ryr1 G T 7: 29,094,242 T1267K possibly damaging Het
Sis G A 3: 72,956,149 T252I probably damaging Het
Slc41a3 A T 6: 90,635,330 S201C probably damaging Het
Slitrk1 A C 14: 108,911,303 S659A probably benign Het
Snx25 A T 8: 46,035,678 M880K probably damaging Het
Tbxas1 C T 6: 39,027,779 T320I probably benign Het
Tex44 T C 1: 86,427,767 V466A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tnxb C T 17: 34,678,662 Q804* probably null Het
Tpst1 T A 5: 130,102,502 M271K probably benign Het
Trank1 C T 9: 111,365,197 T763I possibly damaging Het
Trip12 A T 1: 84,725,741 H729Q probably damaging Het
Tshz3 A T 7: 36,769,605 T340S probably damaging Het
Ttc5 T C 14: 50,781,505 K52E probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Wsb2 T G 5: 117,363,578 probably benign Het
Other mutations in Abtb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01487:Abtb1 APN 6 88839449 missense probably damaging 0.98
IGL02264:Abtb1 APN 6 88836535 missense probably benign 0.00
IGL02376:Abtb1 APN 6 88838484 splice site probably benign
IGL02702:Abtb1 APN 6 88838138 missense probably benign
IGL03132:Abtb1 APN 6 88838959 missense probably benign 0.01
IGL03266:Abtb1 APN 6 88838934 missense probably damaging 0.97
PIT4243001:Abtb1 UTSW 6 88838726 missense probably benign 0.16
PIT4418001:Abtb1 UTSW 6 88839648 missense possibly damaging 0.78
R0331:Abtb1 UTSW 6 88840702 unclassified probably benign
R0763:Abtb1 UTSW 6 88838279 missense probably damaging 0.96
R1565:Abtb1 UTSW 6 88836554 missense probably benign 0.03
R1796:Abtb1 UTSW 6 88836619 missense possibly damaging 0.68
R1822:Abtb1 UTSW 6 88836554 missense probably benign 0.03
R1824:Abtb1 UTSW 6 88836554 missense probably benign 0.03
R2225:Abtb1 UTSW 6 88836367 missense probably damaging 1.00
R2227:Abtb1 UTSW 6 88836367 missense probably damaging 1.00
R2399:Abtb1 UTSW 6 88838738 missense possibly damaging 0.89
R4625:Abtb1 UTSW 6 88836287 missense probably benign 0.00
R5312:Abtb1 UTSW 6 88838258 missense probably damaging 1.00
R5552:Abtb1 UTSW 6 88836548 missense probably benign 0.04
R6035:Abtb1 UTSW 6 88841806 missense probably damaging 1.00
R6035:Abtb1 UTSW 6 88841806 missense probably damaging 1.00
R6092:Abtb1 UTSW 6 88838451 missense probably benign
R6195:Abtb1 UTSW 6 88840736 missense probably benign 0.04
R7257:Abtb1 UTSW 6 88839452 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGCGGATGTCATCGACGAG -3'
(R):5'- GATGATCCCCTGTGTCCTGTTG -3'

Sequencing Primer
(F):5'- TGTCATCGACGAGCGGGATG -3'
(R):5'- GTTGTCCCTTTTCGTGTCACAG -3'
Posted On2015-07-06