Mutagenetix > Incidental Mutation

Incidental Mutation 'R0013:Slit3'

32653

Institutional Source

Beutler Lab

Gene Symbol

Slit3

Ensembl Gene

ENSMUSG00000056427

Gene Name

slit guidance ligand 3

Synonyms

Slit1

MMRRC Submission

038308-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.878) question?

Stock #

R0013 (G1)

Quality Score

159

Status

Validated

Chromosome

Chromosomal Location

35121224-35708507 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 35707918 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 1450 (M1450V)

Ref Sequence

ENSEMBL: ENSMUSP00000066857 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069837]

AlphaFold

Q9WVB4

Predicted Effect

probably benign
Transcript: ENSMUST00000069837
AA Change: M1450V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000066857
Gene: ENSMUSG00000056427
AA Change: M1450V

Domain	Start	End	E-Value	Type
low complexity region	2	23	N/A	INTRINSIC
LRRNT	33	65	2.12e-8	SMART
LRR	59	83	1.37e2	SMART
LRR_TYP	84	107	1.12e-3	SMART
LRR_TYP	108	131	7.78e-3	SMART
LRR_TYP	132	155	5.42e-2	SMART
LRR	156	179	5.88e0	SMART
LRR	180	203	7.55e-1	SMART
LRRCT	215	264	1.33e-6	SMART
LRRNT	279	311	6.79e-7	SMART
LRR	305	329	1.16e2	SMART
LRR	330	353	1.26e1	SMART
LRR_TYP	354	377	2.79e-4	SMART
LRR	378	401	4.05e-1	SMART
LRR	402	425	4.05e-1	SMART
LRRCT	437	486	7.75e-8	SMART
LRRNT	504	536	1.95e-7	SMART
LRR_TYP	556	579	7.49e-5	SMART
LRR	581	603	6.41e1	SMART
LRR_TYP	604	627	2.53e-2	SMART
LRR	628	651	1.76e-1	SMART
LRRCT	663	712	2.52e-7	SMART
LRRNT	724	756	3e-8	SMART
LRR	774	797	2.14e0	SMART
LRR_TYP	798	821	2.95e-3	SMART
LRR_TYP	822	845	2.43e-4	SMART
LRRCT	857	906	1.12e-13	SMART
EGF	919	953	6.86e-4	SMART
EGF	958	994	8.84e-7	SMART
EGF	999	1032	1.13e-4	SMART
EGF	1037	1072	2.3e-5	SMART
EGF_CA	1074	1110	5.92e-8	SMART
EGF	1122	1155	3.79e-6	SMART
LamG	1178	1314	3.16e-34	SMART
EGF	1331	1365	2.19e-2	SMART
EGF	1371	1403	1.13e-4	SMART
EGF	1411	1444	5.57e-4	SMART
CT	1455	1523	4.56e-5	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.8%

Validation Efficiency

94% (79/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is secreted, likely interacting with roundabout homolog receptors to effect cell migration. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a gene trap allele show congenital diaphragmatic hernia (CDH), variable renal defects and enlarged heart right ventricles. Mice homozygous for either of two reporter alleles show diaphragm dysgenesis and die prematurely; those with end-stage CDH show dyspnea and lung congestion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610028H24Rik	A	G	10: 76,457,512	M156V	probably benign	Het
Adnp2	A	T	18: 80,129,745	V483D	probably damaging	Het
Aff1	G	T	5: 103,828,484	E491*	probably null	Het
Agl	A	T	3: 116,776,608	C911*	probably null	Het
Akt2	A	G	7: 27,636,058	D284G	probably damaging	Het
Alox15	A	G	11: 70,349,635	M240T	possibly damaging	Het
Antxr2	A	G	5: 97,979,985	V229A	probably damaging	Het
Arap2	G	A	5: 62,683,484	L680F	probably damaging	Het
Btaf1	A	G	19: 36,958,373	T188A	probably benign	Het
Btnl6	G	A	17: 34,515,531	Q86*	probably null	Het
C2cd3	T	A	7: 100,416,062	L685H	probably damaging	Het
Cdh23	T	C	10: 60,413,173	T878A	possibly damaging	Het
Clec4b2	T	C	6: 123,202,149	Y137H	probably damaging	Het
Dchs1	T	A	7: 105,755,836	T2500S	possibly damaging	Het
Def6	A	G	17: 28,217,092	Y75C	probably damaging	Het
Dhx33	A	T	11: 70,993,635	F448L	probably damaging	Het
Dner	C	T	1: 84,494,893		probably benign	Het
Dnmbp	G	A	19: 43,902,231	P366S	probably benign	Het
Eif4g3	T	C	4: 138,175,848	C1160R	possibly damaging	Het
Elmod1	G	A	9: 53,912,901		probably benign	Het
Faah	C	A	4: 116,004,391	L305F	probably damaging	Het
Fam71b	A	G	11: 46,406,804	T312A	unknown	Het
Flt1	A	G	5: 147,571,014		probably benign	Het
Fyco1	A	T	9: 123,822,406	N1196K	probably benign	Het
Galnt18	T	C	7: 111,554,457	N320S	probably damaging	Het
Glp2r	C	A	11: 67,709,712	G437V	possibly damaging	Het
Gm4884	T	C	7: 41,044,292	S562P	probably damaging	Het
Gm9936	A	G	5: 114,857,347		probably benign	Het
Gpn2	C	A	4: 133,584,792	P112T	probably damaging	Het
Grm4	A	G	17: 27,431,575	Y816H	probably benign	Het
Helz2	A	T	2: 181,240,959	S14T	probably benign	Het
Htt	T	C	5: 34,820,104	L778P	probably benign	Het
Il11ra1	T	C	4: 41,765,060	S129P	probably damaging	Het
Ints11	T	C	4: 155,887,168	F315S	probably damaging	Het
Itga11	A	T	9: 62,776,613	N1059Y	possibly damaging	Het
Jak3	A	G	8: 71,684,327	S716G	probably damaging	Het
Kcns1	G	T	2: 164,168,643	D65E	probably benign	Het
Kdm5d	A	T	Y: 941,715	K1305N	probably benign	Het
Kif26a	G	T	12: 112,177,880	V1523L	probably benign	Het
Mboat7	A	G	7: 3,683,822	S340P	probably damaging	Het
Mctp2	T	C	7: 72,229,408	I234V	probably benign	Het
Mex3c	G	A	18: 73,590,551	A572T	probably benign	Het
Mpp3	C	A	11: 102,005,425	R424L	probably benign	Het
Mroh4	T	A	15: 74,608,237		probably benign	Het
Myo9a	A	T	9: 59,860,206		probably benign	Het
Myog	T	A	1: 134,290,235	H60Q	probably damaging	Het
Nlrp9a	T	A	7: 26,571,225		probably null	Het
Notch1	A	G	2: 26,473,818	V868A	possibly damaging	Het
Olfr352	A	G	2: 36,870,160	N198S	probably damaging	Het
Olfr59	T	A	11: 74,289,051	I135N	possibly damaging	Het
Olfr73	T	C	2: 88,034,266	Y291C	possibly damaging	Het
Olfr980	A	T	9: 40,006,355	I198N	probably damaging	Het
Pink1	T	C	4: 138,317,401	T342A	probably benign	Het
Plb1	T	A	5: 32,349,615		probably benign	Het
Plec	T	C	15: 76,178,246	D2524G	probably damaging	Het
Plekhg4	G	T	8: 105,375,396	E6*	probably null	Het
Polq	T	C	16: 37,061,839	F1455S	possibly damaging	Het
Ppm1e	A	G	11: 87,249,058		probably benign	Het
Prkaca	G	A	8: 83,988,303	M119I	possibly damaging	Het
Prss46	G	T	9: 110,850,055	S108I	probably damaging	Het
Ptma	C	T	1: 86,529,776		probably benign	Het
Rab11fip4	C	T	11: 79,689,653	T437M	probably benign	Het
Rngtt	T	A	4: 33,379,409	M437K	probably benign	Het
Rrn3	T	A	16: 13,813,113	D604E	possibly damaging	Het
Scn4a	A	G	11: 106,348,405		probably benign	Het
Sis	A	G	3: 72,910,476	L1468P	possibly damaging	Het
Smg5	T	C	3: 88,349,233	S269P	probably benign	Het
Sntg1	T	C	1: 8,463,462	T323A	probably damaging	Het
Son	C	T	16: 91,651,662	T37I	probably damaging	Het
Stk17b	T	C	1: 53,764,132	I41M	probably benign	Het
Tgm5	T	A	2: 121,076,882	Y120F	probably damaging	Het
Tppp	A	G	13: 74,021,360	K73R	possibly damaging	Het
Ttn	C	A	2: 76,739,158	K27130N	probably damaging	Het
Ttn	C	T	2: 76,907,752	V4148I	probably benign	Het
Uba7	A	T	9: 107,978,249	Y375F	probably damaging	Het
Ugcg	T	C	4: 59,213,931	L171P	possibly damaging	Het
Vsig2	T	C	9: 37,542,576		probably benign	Het
Zcchc11	T	A	4: 108,530,955		probably benign	Het
Zfp839	T	A	12: 110,868,386	S692T	possibly damaging	Het

Other mutations in Slit3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00731:Slit3	APN	11	35622154	missense	probably damaging	1.00
IGL01324:Slit3	APN	11	35610702	missense	probably damaging	1.00
IGL01612:Slit3	APN	11	35700384	missense	possibly damaging	0.95
IGL02145:Slit3	APN	11	35629742	missense	probably damaging	0.99
IGL02146:Slit3	APN	11	35234848	missense	possibly damaging	0.71
IGL02430:Slit3	APN	11	35177774	splice site	probably null
IGL02528:Slit3	APN	11	35578974	missense	probably benign
IGL02530:Slit3	APN	11	35708142	makesense	probably null
IGL02640:Slit3	APN	11	35700345	missense	probably benign	0.10
IGL02819:Slit3	APN	11	35171590	missense	possibly damaging	0.71
IGL02839:Slit3	APN	11	35649047	missense	possibly damaging	0.46
IGL03150:Slit3	APN	11	35508257	missense	possibly damaging	0.88
IGL03161:Slit3	APN	11	35700414	missense	probably benign	0.10
IGL03336:Slit3	APN	11	35670101	missense	probably damaging	0.97
Bloated	UTSW	11	35633952	missense	possibly damaging	0.55
Quellung	UTSW	11	35651820	critical splice donor site	probably null
IGL02988:Slit3	UTSW	11	35708063	missense	probably damaging	0.99
PIT4791001:Slit3	UTSW	11	35661245	missense	possibly damaging	0.85
R0013:Slit3	UTSW	11	35707918	missense	probably benign
R0334:Slit3	UTSW	11	35579101	missense	probably damaging	0.97
R0385:Slit3	UTSW	11	35700282	missense	probably damaging	0.98
R0840:Slit3	UTSW	11	35623436	splice site	probably benign
R1065:Slit3	UTSW	11	35121635	missense	possibly damaging	0.86
R1364:Slit3	UTSW	11	35670107	missense	probably benign
R1476:Slit3	UTSW	11	35686299	missense	probably damaging	0.97
R1508:Slit3	UTSW	11	35570621	missense	probably damaging	1.00
R1665:Slit3	UTSW	11	35234906	missense	possibly damaging	0.71
R1692:Slit3	UTSW	11	35659344	missense	probably damaging	1.00
R1696:Slit3	UTSW	11	35675923	missense	probably damaging	0.99
R1727:Slit3	UTSW	11	35629832	missense	probably damaging	1.00
R1752:Slit3	UTSW	11	35564653	missense	probably damaging	0.98
R1970:Slit3	UTSW	11	35630841	critical splice acceptor site	probably null
R2077:Slit3	UTSW	11	35544748	missense	possibly damaging	0.88
R2126:Slit3	UTSW	11	35688679	missense	probably damaging	1.00
R2143:Slit3	UTSW	11	35612261	splice site	probably null
R2162:Slit3	UTSW	11	35688682	missense	probably null	1.00
R2873:Slit3	UTSW	11	35544793	nonsense	probably null
R3813:Slit3	UTSW	11	35675979	missense	probably damaging	1.00
R3831:Slit3	UTSW	11	35688682	missense	probably null	1.00
R3832:Slit3	UTSW	11	35688682	missense	probably null	1.00
R3833:Slit3	UTSW	11	35688682	missense	probably null	1.00
R3839:Slit3	UTSW	11	35508237	missense	probably benign	0.10
R4152:Slit3	UTSW	11	35698320	missense	probably damaging	0.98
R4387:Slit3	UTSW	11	35684048	missense	probably benign	0.12
R4795:Slit3	UTSW	11	35651820	critical splice donor site	probably null
R4910:Slit3	UTSW	11	35632722	missense	probably damaging	0.99
R4933:Slit3	UTSW	11	35688593	missense	probably damaging	1.00
R5048:Slit3	UTSW	11	35588985	missense	probably damaging	1.00
R5106:Slit3	UTSW	11	35612367	missense	probably damaging	1.00
R5138:Slit3	UTSW	11	35588985	missense	probably damaging	1.00
R5218:Slit3	UTSW	11	35684175	critical splice donor site	probably null
R5338:Slit3	UTSW	11	35622148	missense	probably benign
R5354:Slit3	UTSW	11	35675913	missense	probably damaging	1.00
R5436:Slit3	UTSW	11	35707911	missense	probably benign	0.05
R5896:Slit3	UTSW	11	35708105	missense	probably damaging	0.99
R5933:Slit3	UTSW	11	35629751	missense	probably benign	0.04
R5963:Slit3	UTSW	11	35700236	missense	probably damaging	1.00
R5964:Slit3	UTSW	11	35700236	missense	probably damaging	1.00
R6125:Slit3	UTSW	11	35570733	critical splice donor site	probably null
R6153:Slit3	UTSW	11	35700483	missense	possibly damaging	0.69
R6484:Slit3	UTSW	11	35661298	missense	probably benign
R6526:Slit3	UTSW	11	35661292	missense	probably benign	0.33
R6797:Slit3	UTSW	11	35633952	missense	possibly damaging	0.55
R6887:Slit3	UTSW	11	35544806	splice site	probably null
R7067:Slit3	UTSW	11	35508230	missense	probably benign	0.04
R7150:Slit3	UTSW	11	35570719	missense	probably damaging	1.00
R7228:Slit3	UTSW	11	35599418	missense	probably damaging	1.00
R7232:Slit3	UTSW	11	35610689	missense	possibly damaging	0.87
R7418:Slit3	UTSW	11	35686428	missense	possibly damaging	0.64
R7545:Slit3	UTSW	11	35700312	missense	possibly damaging	0.52
R7727:Slit3	UTSW	11	35684044	missense	probably damaging	1.00
R7820:Slit3	UTSW	11	35700408	missense	probably benign	0.23
R8177:Slit3	UTSW	11	35579092	missense	probably damaging	0.99
R8179:Slit3	UTSW	11	35664076	missense	probably benign	0.31
R8416:Slit3	UTSW	11	35508235	missense	probably benign	0.08
R8417:Slit3	UTSW	11	35610611	missense	probably damaging	0.99
R8476:Slit3	UTSW	11	35629769	missense	possibly damaging	0.70
R8785:Slit3	UTSW	11	35670141	missense	probably damaging	0.98
R8955:Slit3	UTSW	11	35698380	missense	probably damaging	0.97
R9040:Slit3	UTSW	11	35703309	missense	probably damaging	0.98
R9068:Slit3	UTSW	11	35684090	missense	probably damaging	1.00
R9088:Slit3	UTSW	11	35121636	missense	possibly damaging	0.86
R9266:Slit3	UTSW	11	35707981	missense	probably damaging	0.98
R9539:Slit3	UTSW	11	35698328	nonsense	probably null
R9636:Slit3	UTSW	11	35703261	missense	probably damaging	0.97
X0028:Slit3	UTSW	11	35564637	missense	probably damaging	0.99
Z1176:Slit3	UTSW	11	35707924	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACTTGTGTGTCCCAACATGCCC -3'
(R):5'- GAAGACATATTTCCGCCGCTTGC -3'

Sequencing Primer
(F):5'- tccaggggctgctagac -3'
(R):5'- GCTTGCTTCGAATCGGC -3'

Posted On

2013-05-09