Incidental Mutation 'R4394:Olfr830'
ID326538
Institutional Source Beutler Lab
Gene Symbol Olfr830
Ensembl Gene ENSMUSG00000062868
Gene Nameolfactory receptor 830
SynonymsGA_x6K02T2PVTD-12618399-12619337, MOR152-1
MMRRC Submission 041683-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R4394 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location18874693-18878369 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18875611 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 95 (I95L)
Ref Sequence ENSEMBL: ENSMUSP00000077903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078861] [ENSMUST00000212723]
Predicted Effect probably damaging
Transcript: ENSMUST00000078861
AA Change: I95L

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000077903
Gene: ENSMUSG00000062868
AA Change: I95L

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 1.8e-51 PFAM
Pfam:7tm_1 44 293 1.6e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212723
AA Change: I92L

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A G 6: 88,836,584 F391L probably damaging Het
AC140205.10 C A 8: 20,833,165 T192K probably benign Het
Arid4b T A 13: 14,154,972 probably null Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Brip1 A T 11: 86,074,298 N855K possibly damaging Het
Ces2f A G 8: 104,950,954 N197S probably damaging Het
Chd4 A G 6: 125,121,618 T1520A probably damaging Het
Cltc A C 11: 86,733,630 N159K probably damaging Het
Cntn1 C T 15: 92,291,764 T656I probably damaging Het
Crybg3 A G 16: 59,560,095 probably benign Het
Dzip1l T A 9: 99,639,854 L181H probably damaging Het
Fam3b C A 16: 97,481,786 probably null Het
Fat1 T A 8: 44,952,346 N711K probably damaging Het
Fat3 A G 9: 15,922,792 I4168T probably benign Het
Fbxw20 T C 9: 109,232,330 D117G probably benign Het
Gm8122 A G 14: 43,234,068 L81P unknown Het
Hal T C 10: 93,496,559 probably benign Het
Hgf T A 5: 16,618,951 Y715* probably null Het
Hid1 T A 11: 115,367,642 probably benign Het
Hyou1 T A 9: 44,381,872 V125E probably damaging Het
Jrkl G A 9: 13,245,141 Q172* probably null Het
Lamc3 A G 2: 31,931,952 E1304G probably benign Het
Lman2l A C 1: 36,439,723 C103G probably damaging Het
Lrfn5 T C 12: 61,843,490 S522P probably damaging Het
Mark3 A T 12: 111,604,523 I86L possibly damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mgst2 G A 3: 51,664,528 V26I probably damaging Het
Neb A T 2: 52,187,513 Y158* probably null Het
Nipbl T C 15: 8,361,861 I210V probably benign Het
Olfr1057 C T 2: 86,375,179 A78T possibly damaging Het
Pcdhb8 C T 18: 37,356,882 P538S probably damaging Het
Postn A G 3: 54,370,955 D295G probably damaging Het
Prss38 T C 11: 59,373,028 Y286C probably damaging Het
Psen2 A T 1: 180,240,782 V102E probably damaging Het
Ptpn9 A T 9: 57,036,563 K126N possibly damaging Het
Ptprd A G 4: 76,128,685 I435T probably damaging Het
Rab39 T C 9: 53,686,650 K105R probably benign Het
Robo2 C A 16: 73,948,379 R840L probably benign Het
Rps6ka5 T A 12: 100,581,319 I311F probably damaging Het
Ryr1 G T 7: 29,094,242 T1267K possibly damaging Het
Sis G A 3: 72,956,149 T252I probably damaging Het
Slc41a3 A T 6: 90,635,330 S201C probably damaging Het
Slitrk1 A C 14: 108,911,303 S659A probably benign Het
Snx25 A T 8: 46,035,678 M880K probably damaging Het
Tbxas1 C T 6: 39,027,779 T320I probably benign Het
Tex44 T C 1: 86,427,767 V466A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tnxb C T 17: 34,678,662 Q804* probably null Het
Tpst1 T A 5: 130,102,502 M271K probably benign Het
Trank1 C T 9: 111,365,197 T763I possibly damaging Het
Trip12 A T 1: 84,725,741 H729Q probably damaging Het
Tshz3 A T 7: 36,769,605 T340S probably damaging Het
Ttc5 T C 14: 50,781,505 K52E probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Wsb2 T G 5: 117,363,578 probably benign Het
Other mutations in Olfr830
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Olfr830 APN 9 18876014 nonsense probably null
IGL00954:Olfr830 APN 9 18876073 missense probably benign 0.15
IGL01090:Olfr830 APN 9 18876242 missense probably benign 0.00
IGL01613:Olfr830 APN 9 18875321 splice site probably benign
IGL01987:Olfr830 APN 9 18875707 missense probably benign 0.00
IGL03018:Olfr830 APN 9 18876227 missense probably benign 0.15
IGL03037:Olfr830 APN 9 18875372 missense probably damaging 0.98
R0284:Olfr830 UTSW 9 18875552 missense probably benign
R1322:Olfr830 UTSW 9 18875521 missense possibly damaging 0.90
R1715:Olfr830 UTSW 9 18875794 missense probably benign 0.06
R1803:Olfr830 UTSW 9 18876080 missense probably damaging 1.00
R4360:Olfr830 UTSW 9 18875717 missense probably damaging 1.00
R4642:Olfr830 UTSW 9 18876167 missense probably damaging 1.00
R4796:Olfr830 UTSW 9 18876179 missense probably damaging 0.96
R4814:Olfr830 UTSW 9 18875917 missense probably benign 0.30
R5210:Olfr830 UTSW 9 18875807 missense probably damaging 1.00
R5375:Olfr830 UTSW 9 18876146 missense probably benign 0.08
R6072:Olfr830 UTSW 9 18875422 missense probably benign
R6361:Olfr830 UTSW 9 18875731 missense probably damaging 1.00
R6602:Olfr830 UTSW 9 18875849 missense possibly damaging 0.81
R6920:Olfr830 UTSW 9 18875525 missense probably damaging 1.00
R7730:Olfr830 UTSW 9 18875413 missense probably benign 0.00
R7780:Olfr830 UTSW 9 18875614 missense possibly damaging 0.65
R8245:Olfr830 UTSW 9 18875830 missense probably benign
R8274:Olfr830 UTSW 9 18875499 missense probably benign 0.36
X0026:Olfr830 UTSW 9 18875635 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGCAGCCATTCATCTTTG -3'
(R):5'- AGACTATGCAGCAGACCATTTAC -3'

Sequencing Primer
(F):5'- GCAGCCATTCATCTTTGTTCTTTTTC -3'
(R):5'- TATGCAGCAGACCATTTACAATAC -3'
Posted On2015-07-06