Incidental Mutation 'R4394:Dzip1l'
ID326542
Institutional Source Beutler Lab
Gene Symbol Dzip1l
Ensembl Gene ENSMUSG00000037784
Gene NameDAZ interacting protein 1-like
Synonyms
MMRRC Submission 041683-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R4394 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location99629496-99669256 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 99639854 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 181 (L181H)
Ref Sequence ENSEMBL: ENSMUSP00000108507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078367] [ENSMUST00000112884] [ENSMUST00000112885] [ENSMUST00000112886] [ENSMUST00000131095]
Predicted Effect probably damaging
Transcript: ENSMUST00000078367
AA Change: L181H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077475
Gene: ENSMUSG00000037784
AA Change: L181H

DomainStartEndE-ValueType
Pfam:Dzip-like_N 24 144 5e-48 PFAM
low complexity region 153 159 N/A INTRINSIC
ZnF_C2H2 166 189 3.34e-2 SMART
low complexity region 221 238 N/A INTRINSIC
SCOP:d1eq1a_ 242 411 2e-3 SMART
low complexity region 422 441 N/A INTRINSIC
low complexity region 597 622 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112884
AA Change: L181H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108505
Gene: ENSMUSG00000037784
AA Change: L181H

DomainStartEndE-ValueType
Pfam:Dzip-like_N 24 144 9.8e-48 PFAM
low complexity region 153 159 N/A INTRINSIC
ZnF_C2H2 166 189 3.34e-2 SMART
low complexity region 221 238 N/A INTRINSIC
SCOP:d1eq1a_ 242 411 2e-3 SMART
low complexity region 422 441 N/A INTRINSIC
low complexity region 597 621 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112885
AA Change: L181H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108506
Gene: ENSMUSG00000037784
AA Change: L181H

DomainStartEndE-ValueType
Pfam:Dzip-like_N 24 144 9.8e-48 PFAM
low complexity region 153 159 N/A INTRINSIC
ZnF_C2H2 166 189 3.34e-2 SMART
low complexity region 221 238 N/A INTRINSIC
SCOP:d1eq1a_ 242 411 2e-3 SMART
low complexity region 422 441 N/A INTRINSIC
low complexity region 597 622 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112886
AA Change: L181H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108507
Gene: ENSMUSG00000037784
AA Change: L181H

DomainStartEndE-ValueType
Pfam:Dzip-like_N 24 144 9.8e-48 PFAM
low complexity region 153 159 N/A INTRINSIC
ZnF_C2H2 166 189 3.34e-2 SMART
low complexity region 221 238 N/A INTRINSIC
SCOP:d1eq1a_ 242 411 2e-3 SMART
low complexity region 422 441 N/A INTRINSIC
low complexity region 597 621 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131095
SMART Domains Protein: ENSMUSP00000116647
Gene: ENSMUSG00000037784

DomainStartEndE-ValueType
Pfam:Dzip-like_N 24 125 6.3e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134969
Meta Mutation Damage Score 0.8727 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A G 6: 88,836,584 F391L probably damaging Het
AC140205.10 C A 8: 20,833,165 T192K probably benign Het
Arid4b T A 13: 14,154,972 probably null Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Brip1 A T 11: 86,074,298 N855K possibly damaging Het
Ces2f A G 8: 104,950,954 N197S probably damaging Het
Chd4 A G 6: 125,121,618 T1520A probably damaging Het
Cltc A C 11: 86,733,630 N159K probably damaging Het
Cntn1 C T 15: 92,291,764 T656I probably damaging Het
Crybg3 A G 16: 59,560,095 probably benign Het
Fam3b C A 16: 97,481,786 probably null Het
Fat1 T A 8: 44,952,346 N711K probably damaging Het
Fat3 A G 9: 15,922,792 I4168T probably benign Het
Fbxw20 T C 9: 109,232,330 D117G probably benign Het
Gm8122 A G 14: 43,234,068 L81P unknown Het
Hal T C 10: 93,496,559 probably benign Het
Hgf T A 5: 16,618,951 Y715* probably null Het
Hid1 T A 11: 115,367,642 probably benign Het
Hyou1 T A 9: 44,381,872 V125E probably damaging Het
Jrkl G A 9: 13,245,141 Q172* probably null Het
Lamc3 A G 2: 31,931,952 E1304G probably benign Het
Lman2l A C 1: 36,439,723 C103G probably damaging Het
Lrfn5 T C 12: 61,843,490 S522P probably damaging Het
Mark3 A T 12: 111,604,523 I86L possibly damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mgst2 G A 3: 51,664,528 V26I probably damaging Het
Neb A T 2: 52,187,513 Y158* probably null Het
Nipbl T C 15: 8,361,861 I210V probably benign Het
Olfr1057 C T 2: 86,375,179 A78T possibly damaging Het
Olfr830 A T 9: 18,875,611 I95L probably damaging Het
Pcdhb8 C T 18: 37,356,882 P538S probably damaging Het
Postn A G 3: 54,370,955 D295G probably damaging Het
Prss38 T C 11: 59,373,028 Y286C probably damaging Het
Psen2 A T 1: 180,240,782 V102E probably damaging Het
Ptpn9 A T 9: 57,036,563 K126N possibly damaging Het
Ptprd A G 4: 76,128,685 I435T probably damaging Het
Rab39 T C 9: 53,686,650 K105R probably benign Het
Robo2 C A 16: 73,948,379 R840L probably benign Het
Rps6ka5 T A 12: 100,581,319 I311F probably damaging Het
Ryr1 G T 7: 29,094,242 T1267K possibly damaging Het
Sis G A 3: 72,956,149 T252I probably damaging Het
Slc41a3 A T 6: 90,635,330 S201C probably damaging Het
Slitrk1 A C 14: 108,911,303 S659A probably benign Het
Snx25 A T 8: 46,035,678 M880K probably damaging Het
Tbxas1 C T 6: 39,027,779 T320I probably benign Het
Tex44 T C 1: 86,427,767 V466A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tnxb C T 17: 34,678,662 Q804* probably null Het
Tpst1 T A 5: 130,102,502 M271K probably benign Het
Trank1 C T 9: 111,365,197 T763I possibly damaging Het
Trip12 A T 1: 84,725,741 H729Q probably damaging Het
Tshz3 A T 7: 36,769,605 T340S probably damaging Het
Ttc5 T C 14: 50,781,505 K52E probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Wsb2 T G 5: 117,363,578 probably benign Het
Other mutations in Dzip1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dzip1l APN 9 99637777 missense probably damaging 0.99
IGL01992:Dzip1l APN 9 99663686 missense probably damaging 1.00
R0276:Dzip1l UTSW 9 99660998 missense probably benign 0.38
R0506:Dzip1l UTSW 9 99663081 missense possibly damaging 0.76
R1469:Dzip1l UTSW 9 99659776 critical splice donor site probably null
R1469:Dzip1l UTSW 9 99659776 critical splice donor site probably null
R2904:Dzip1l UTSW 9 99663669 missense probably damaging 0.99
R2905:Dzip1l UTSW 9 99663669 missense probably damaging 0.99
R2911:Dzip1l UTSW 9 99655602 missense probably benign 0.00
R3106:Dzip1l UTSW 9 99642572 nonsense probably null
R3106:Dzip1l UTSW 9 99647121 missense probably benign 0.00
R4570:Dzip1l UTSW 9 99647168 nonsense probably null
R4579:Dzip1l UTSW 9 99647214 missense probably damaging 1.00
R4695:Dzip1l UTSW 9 99647205 missense probably benign 0.11
R4696:Dzip1l UTSW 9 99663611 missense possibly damaging 0.94
R4748:Dzip1l UTSW 9 99642651 missense probably damaging 0.96
R5063:Dzip1l UTSW 9 99667652 missense probably damaging 1.00
R5747:Dzip1l UTSW 9 99639809 splice site probably null
R6089:Dzip1l UTSW 9 99642684 missense possibly damaging 0.63
R7030:Dzip1l UTSW 9 99665835 missense probably benign 0.00
R7454:Dzip1l UTSW 9 99659674 missense possibly damaging 0.59
R7485:Dzip1l UTSW 9 99661012 missense probably benign 0.02
R7706:Dzip1l UTSW 9 99637536 missense probably damaging 1.00
R7734:Dzip1l UTSW 9 99667682 missense probably damaging 1.00
R7790:Dzip1l UTSW 9 99660962 missense possibly damaging 0.58
Z1176:Dzip1l UTSW 9 99641761 missense possibly damaging 0.59
Z1177:Dzip1l UTSW 9 99665854 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TCACCCTCAGAAATGTACTGTTTC -3'
(R):5'- TTGTCCCCTACACAGGCAAG -3'

Sequencing Primer
(F):5'- GGAATTGAACCTAGGGTCTCACC -3'
(R):5'- AGCAGGTCTATGTGCATG -3'
Posted On2015-07-06