Incidental Mutation 'R4394:Hal'
ID326545
Institutional Source Beutler Lab
Gene Symbol Hal
Ensembl Gene ENSMUSG00000020017
Gene Namehistidine ammonia lyase
Synonymshistidase, Hsd
MMRRC Submission 041683-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R4394 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location93488768-93519304 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 93496559 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016031] [ENSMUST00000129421]
Predicted Effect probably benign
Transcript: ENSMUST00000016031
SMART Domains Protein: ENSMUSP00000016031
Gene: ENSMUSG00000020017

DomainStartEndE-ValueType
low complexity region 60 71 N/A INTRINSIC
SCOP:d1gkma_ 114 161 6e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129421
SMART Domains Protein: ENSMUSP00000123336
Gene: ENSMUSG00000020017

DomainStartEndE-ValueType
Pfam:DUF3534 3 128 6e-9 PFAM
Pfam:Lyase_aromatic 116 590 1.3e-199 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152883
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: This gene encodes a member of the histidase protein family. The encoded protein is a cytosolic enzyme which catalyzes the first reaction in histidine catabolism. Defects in this protein cause histidinemia, which is characterized by increased histidine in blood, urine, and cerebrospinal fluid. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mutations in this gene cause elevated histidine levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A G 6: 88,836,584 F391L probably damaging Het
AC140205.10 C A 8: 20,833,165 T192K probably benign Het
Arid4b T A 13: 14,154,972 probably null Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Brip1 A T 11: 86,074,298 N855K possibly damaging Het
Ces2f A G 8: 104,950,954 N197S probably damaging Het
Chd4 A G 6: 125,121,618 T1520A probably damaging Het
Cltc A C 11: 86,733,630 N159K probably damaging Het
Cntn1 C T 15: 92,291,764 T656I probably damaging Het
Crybg3 A G 16: 59,560,095 probably benign Het
Dzip1l T A 9: 99,639,854 L181H probably damaging Het
Fam3b C A 16: 97,481,786 probably null Het
Fat1 T A 8: 44,952,346 N711K probably damaging Het
Fat3 A G 9: 15,922,792 I4168T probably benign Het
Fbxw20 T C 9: 109,232,330 D117G probably benign Het
Gm8122 A G 14: 43,234,068 L81P unknown Het
Hgf T A 5: 16,618,951 Y715* probably null Het
Hid1 T A 11: 115,367,642 probably benign Het
Hyou1 T A 9: 44,381,872 V125E probably damaging Het
Jrkl G A 9: 13,245,141 Q172* probably null Het
Lamc3 A G 2: 31,931,952 E1304G probably benign Het
Lman2l A C 1: 36,439,723 C103G probably damaging Het
Lrfn5 T C 12: 61,843,490 S522P probably damaging Het
Mark3 A T 12: 111,604,523 I86L possibly damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mgst2 G A 3: 51,664,528 V26I probably damaging Het
Neb A T 2: 52,187,513 Y158* probably null Het
Nipbl T C 15: 8,361,861 I210V probably benign Het
Olfr1057 C T 2: 86,375,179 A78T possibly damaging Het
Olfr830 A T 9: 18,875,611 I95L probably damaging Het
Pcdhb8 C T 18: 37,356,882 P538S probably damaging Het
Postn A G 3: 54,370,955 D295G probably damaging Het
Prss38 T C 11: 59,373,028 Y286C probably damaging Het
Psen2 A T 1: 180,240,782 V102E probably damaging Het
Ptpn9 A T 9: 57,036,563 K126N possibly damaging Het
Ptprd A G 4: 76,128,685 I435T probably damaging Het
Rab39 T C 9: 53,686,650 K105R probably benign Het
Robo2 C A 16: 73,948,379 R840L probably benign Het
Rps6ka5 T A 12: 100,581,319 I311F probably damaging Het
Ryr1 G T 7: 29,094,242 T1267K possibly damaging Het
Sis G A 3: 72,956,149 T252I probably damaging Het
Slc41a3 A T 6: 90,635,330 S201C probably damaging Het
Slitrk1 A C 14: 108,911,303 S659A probably benign Het
Snx25 A T 8: 46,035,678 M880K probably damaging Het
Tbxas1 C T 6: 39,027,779 T320I probably benign Het
Tex44 T C 1: 86,427,767 V466A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tnxb C T 17: 34,678,662 Q804* probably null Het
Tpst1 T A 5: 130,102,502 M271K probably benign Het
Trank1 C T 9: 111,365,197 T763I possibly damaging Het
Trip12 A T 1: 84,725,741 H729Q probably damaging Het
Tshz3 A T 7: 36,769,605 T340S probably damaging Het
Ttc5 T C 14: 50,781,505 K52E probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Wsb2 T G 5: 117,363,578 probably benign Het
Other mutations in Hal
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Hal APN 10 93490069 critical splice donor site probably null
IGL01528:Hal APN 10 93497593 missense probably damaging 1.00
IGL01818:Hal APN 10 93490984 missense probably damaging 0.99
IGL01903:Hal APN 10 93500607 splice site probably benign
IGL02152:Hal APN 10 93503542 missense possibly damaging 0.74
IGL02249:Hal APN 10 93497538 missense probably damaging 0.99
IGL02366:Hal APN 10 93503528 missense probably damaging 1.00
IGL02421:Hal APN 10 93503473 missense probably damaging 0.98
IGL02721:Hal APN 10 93507498 nonsense probably null
2k1 UTSW 10 93514143 critical splice donor site probably null
alger UTSW 10 93507551 critical splice donor site probably null
Whittaker UTSW 10 93516284 missense probably benign
R0048:Hal UTSW 10 93498991 missense probably damaging 1.00
R0238:Hal UTSW 10 93503482 missense possibly damaging 0.61
R0238:Hal UTSW 10 93503482 missense possibly damaging 0.61
R0239:Hal UTSW 10 93503482 missense possibly damaging 0.61
R0239:Hal UTSW 10 93503482 missense possibly damaging 0.61
R0372:Hal UTSW 10 93507553 splice site probably benign
R0465:Hal UTSW 10 93516284 missense probably benign
R0504:Hal UTSW 10 93489174 missense probably damaging 0.99
R1357:Hal UTSW 10 93500623 missense probably damaging 0.96
R1623:Hal UTSW 10 93516297 missense probably benign 0.00
R1757:Hal UTSW 10 93494628 missense probably benign 0.14
R1918:Hal UTSW 10 93496607 missense probably damaging 1.00
R2048:Hal UTSW 10 93491140 missense probably damaging 0.98
R2291:Hal UTSW 10 93503536 missense probably damaging 0.98
R3001:Hal UTSW 10 93507519 missense probably damaging 1.00
R3002:Hal UTSW 10 93507519 missense probably damaging 1.00
R3927:Hal UTSW 10 93514026 splice site probably benign
R3948:Hal UTSW 10 93489907 missense possibly damaging 0.94
R4623:Hal UTSW 10 93507439 missense probably damaging 1.00
R4922:Hal UTSW 10 93503539 missense probably damaging 1.00
R5018:Hal UTSW 10 93507551 critical splice donor site probably null
R5072:Hal UTSW 10 93514042 missense probably damaging 0.99
R5073:Hal UTSW 10 93514042 missense probably damaging 0.99
R5074:Hal UTSW 10 93514042 missense probably damaging 0.99
R5303:Hal UTSW 10 93516365 utr 3 prime probably benign
R5806:Hal UTSW 10 93490984 missense probably damaging 0.97
R5992:Hal UTSW 10 93490916 missense probably damaging 1.00
R6294:Hal UTSW 10 93514143 critical splice donor site probably null
R6370:Hal UTSW 10 93497506 missense probably damaging 1.00
R6747:Hal UTSW 10 93500677 missense probably damaging 1.00
R7142:Hal UTSW 10 93500651 missense possibly damaging 0.85
R7299:Hal UTSW 10 93492561 missense probably benign 0.00
R7301:Hal UTSW 10 93492561 missense probably benign 0.00
Z1176:Hal UTSW 10 93489893 missense probably benign 0.00
Z1177:Hal UTSW 10 93489335 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGAGTCTAAAAGTTGCTAAGTCTGC -3'
(R):5'- TCTTAAGTGCTCACAGAGGAGC -3'

Sequencing Primer
(F):5'- AGTTGCTAAGTCTGCTTTCAAAC -3'
(R):5'- TCACAGAGGAGCCCTTTCAGTG -3'
Posted On2015-07-06