Incidental Mutation 'R4394:Mark3'
ID326553
Institutional Source Beutler Lab
Gene Symbol Mark3
Ensembl Gene ENSMUSG00000007411
Gene NameMAP/microtubule affinity regulating kinase 3
SynonymsA430080F22Rik, ETK-1, C-TAK1, 1600015G02Rik
MMRRC Submission 041683-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R4394 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location111574523-111656221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 111604523 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 86 (I86L)
Ref Sequence ENSEMBL: ENSMUSP00000152727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075281] [ENSMUST00000084953] [ENSMUST00000221448] [ENSMUST00000221459] [ENSMUST00000221753] [ENSMUST00000222870]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075281
AA Change: I86L

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074757
Gene: ENSMUSG00000007411
AA Change: I86L

DomainStartEndE-ValueType
S_TKc 56 307 7.4e-109 SMART
UBA 328 365 6.91e-9 SMART
low complexity region 368 385 N/A INTRINSIC
low complexity region 406 419 N/A INTRINSIC
Pfam:KA1 683 729 3.7e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000084953
AA Change: I86L

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000082017
Gene: ENSMUSG00000007411
AA Change: I86L

DomainStartEndE-ValueType
S_TKc 56 307 7.4e-109 SMART
UBA 328 365 6.91e-9 SMART
low complexity region 368 385 N/A INTRINSIC
low complexity region 406 419 N/A INTRINSIC
Pfam:KA1 700 744 4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221390
Predicted Effect possibly damaging
Transcript: ENSMUST00000221448
AA Change: I86L

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000221459
AA Change: I86L

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221631
Predicted Effect possibly damaging
Transcript: ENSMUST00000221753
AA Change: I86L

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222080
Predicted Effect unknown
Transcript: ENSMUST00000222870
AA Change: I5L
Meta Mutation Damage Score 0.4475 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is activated by phosphorylation and in turn is involved in the phosphorylation of tau proteins MAP2 and MAP4. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous disruption of this gene results in decreased body weight, increased energy expenditure, reduced adiposity, and protection from high-fat diet induced obesity. On a high-fat diet, mice show resistance to hepatic steatosis, improved glucose tolerance, and decreased insulin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A G 6: 88,836,584 F391L probably damaging Het
AC140205.10 C A 8: 20,833,165 T192K probably benign Het
Arid4b T A 13: 14,154,972 probably null Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Brip1 A T 11: 86,074,298 N855K possibly damaging Het
Ces2f A G 8: 104,950,954 N197S probably damaging Het
Chd4 A G 6: 125,121,618 T1520A probably damaging Het
Cltc A C 11: 86,733,630 N159K probably damaging Het
Cntn1 C T 15: 92,291,764 T656I probably damaging Het
Crybg3 A G 16: 59,560,095 probably benign Het
Dzip1l T A 9: 99,639,854 L181H probably damaging Het
Fam3b C A 16: 97,481,786 probably null Het
Fat1 T A 8: 44,952,346 N711K probably damaging Het
Fat3 A G 9: 15,922,792 I4168T probably benign Het
Fbxw20 T C 9: 109,232,330 D117G probably benign Het
Gm8122 A G 14: 43,234,068 L81P unknown Het
Hal T C 10: 93,496,559 probably benign Het
Hgf T A 5: 16,618,951 Y715* probably null Het
Hid1 T A 11: 115,367,642 probably benign Het
Hyou1 T A 9: 44,381,872 V125E probably damaging Het
Jrkl G A 9: 13,245,141 Q172* probably null Het
Lamc3 A G 2: 31,931,952 E1304G probably benign Het
Lman2l A C 1: 36,439,723 C103G probably damaging Het
Lrfn5 T C 12: 61,843,490 S522P probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mgst2 G A 3: 51,664,528 V26I probably damaging Het
Neb A T 2: 52,187,513 Y158* probably null Het
Nipbl T C 15: 8,361,861 I210V probably benign Het
Olfr1057 C T 2: 86,375,179 A78T possibly damaging Het
Olfr830 A T 9: 18,875,611 I95L probably damaging Het
Pcdhb8 C T 18: 37,356,882 P538S probably damaging Het
Postn A G 3: 54,370,955 D295G probably damaging Het
Prss38 T C 11: 59,373,028 Y286C probably damaging Het
Psen2 A T 1: 180,240,782 V102E probably damaging Het
Ptpn9 A T 9: 57,036,563 K126N possibly damaging Het
Ptprd A G 4: 76,128,685 I435T probably damaging Het
Rab39 T C 9: 53,686,650 K105R probably benign Het
Robo2 C A 16: 73,948,379 R840L probably benign Het
Rps6ka5 T A 12: 100,581,319 I311F probably damaging Het
Ryr1 G T 7: 29,094,242 T1267K possibly damaging Het
Sis G A 3: 72,956,149 T252I probably damaging Het
Slc41a3 A T 6: 90,635,330 S201C probably damaging Het
Slitrk1 A C 14: 108,911,303 S659A probably benign Het
Snx25 A T 8: 46,035,678 M880K probably damaging Het
Tbxas1 C T 6: 39,027,779 T320I probably benign Het
Tex44 T C 1: 86,427,767 V466A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tnxb C T 17: 34,678,662 Q804* probably null Het
Tpst1 T A 5: 130,102,502 M271K probably benign Het
Trank1 C T 9: 111,365,197 T763I possibly damaging Het
Trip12 A T 1: 84,725,741 H729Q probably damaging Het
Tshz3 A T 7: 36,769,605 T340S probably damaging Het
Ttc5 T C 14: 50,781,505 K52E probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Wsb2 T G 5: 117,363,578 probably benign Het
Other mutations in Mark3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Mark3 APN 12 111627522 missense probably damaging 0.99
IGL02047:Mark3 APN 12 111618363 missense probably damaging 1.00
IGL02345:Mark3 APN 12 111627107 missense probably damaging 0.99
IGL02637:Mark3 APN 12 111592656 missense probably damaging 0.98
IGL03310:Mark3 APN 12 111647670 missense probably benign
IGL03349:Mark3 APN 12 111628250 missense probably benign 0.19
R0377:Mark3 UTSW 12 111629029 missense probably damaging 0.96
R0551:Mark3 UTSW 12 111633634 missense probably benign
R0846:Mark3 UTSW 12 111627224 missense possibly damaging 0.85
R1104:Mark3 UTSW 12 111618397 splice site probably benign
R1305:Mark3 UTSW 12 111615446 critical splice donor site probably null
R1344:Mark3 UTSW 12 111627837 missense possibly damaging 0.94
R1418:Mark3 UTSW 12 111627837 missense possibly damaging 0.94
R1434:Mark3 UTSW 12 111623325 splice site probably benign
R1556:Mark3 UTSW 12 111627841 missense probably damaging 0.98
R1569:Mark3 UTSW 12 111633746 missense probably benign 0.01
R1582:Mark3 UTSW 12 111655310 missense probably benign 0.12
R1936:Mark3 UTSW 12 111618365 missense probably damaging 0.99
R1975:Mark3 UTSW 12 111615441 missense probably damaging 1.00
R2507:Mark3 UTSW 12 111627242 missense probably damaging 1.00
R4912:Mark3 UTSW 12 111592653 missense probably benign 0.42
R4926:Mark3 UTSW 12 111618324 nonsense probably null
R5060:Mark3 UTSW 12 111618326 missense probably damaging 0.98
R5133:Mark3 UTSW 12 111655328 missense probably damaging 1.00
R5813:Mark3 UTSW 12 111655443 missense probably damaging 1.00
R5834:Mark3 UTSW 12 111624487 missense probably damaging 0.99
R5926:Mark3 UTSW 12 111592734 missense probably damaging 1.00
R6523:Mark3 UTSW 12 111627235 missense probably damaging 1.00
R6663:Mark3 UTSW 12 111575083 missense probably benign 0.42
R6719:Mark3 UTSW 12 111615442 missense probably damaging 1.00
R6942:Mark3 UTSW 12 111592654 missense probably null 0.02
R6966:Mark3 UTSW 12 111640024 missense probably damaging 0.96
R6978:Mark3 UTSW 12 111627148 missense probably benign
R7303:Mark3 UTSW 12 111655536 missense probably damaging 1.00
R7408:Mark3 UTSW 12 111633789 missense probably damaging 0.99
R7454:Mark3 UTSW 12 111604527 missense probably damaging 1.00
R7680:Mark3 UTSW 12 111646773 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGGAAGAGACTTGCTACACTG -3'
(R):5'- GGCTTCACTTGTTTCAACTGGG -3'

Sequencing Primer
(F):5'- GGAAGAGACTTGCTACACTGTATATC -3'
(R):5'- GACAGTTAAAGATCTAAGAGGC -3'
Posted On2015-07-06