Incidental Mutation 'R0013:Dhx33'
ID32656
Institutional Source Beutler Lab
Gene Symbol Dhx33
Ensembl Gene ENSMUSG00000040620
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 33
Synonyms9430096J02Rik, 3110057P17Rik, Ddx33
MMRRC Submission 038308-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0013 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location70984091-71004437 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70993635 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 448 (F448L)
Ref Sequence ENSEMBL: ENSMUSP00000104167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108527] [ENSMUST00000124464] [ENSMUST00000155044]
Predicted Effect probably benign
Transcript: ENSMUST00000049048
SMART Domains Protein: ENSMUSP00000038018
Gene: ENSMUSG00000040620

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
Blast:DEXDc 41 76 3e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083312
Predicted Effect probably damaging
Transcript: ENSMUST00000108527
AA Change: F448L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104167
Gene: ENSMUSG00000040620
AA Change: F448L

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
DEXDc 53 252 1.96e-29 SMART
HELICc 300 401 3.45e-16 SMART
HA2 461 554 3.29e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123860
Predicted Effect probably damaging
Transcript: ENSMUST00000124464
AA Change: F224L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136051
Gene: ENSMUSG00000040620
AA Change: F224L

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
HA2 237 330 3.29e-29 SMART
Pfam:OB_NTP_bind 364 464 7.7e-27 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000146203
AA Change: F62L
Predicted Effect probably benign
Transcript: ENSMUST00000155044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179635
Meta Mutation Damage Score 0.9421 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 94% (79/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. The DEAD box proteins are characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A G 10: 76,457,512 M156V probably benign Het
Adnp2 A T 18: 80,129,745 V483D probably damaging Het
Aff1 G T 5: 103,828,484 E491* probably null Het
Agl A T 3: 116,776,608 C911* probably null Het
Akt2 A G 7: 27,636,058 D284G probably damaging Het
Alox15 A G 11: 70,349,635 M240T possibly damaging Het
Antxr2 A G 5: 97,979,985 V229A probably damaging Het
Arap2 G A 5: 62,683,484 L680F probably damaging Het
Btaf1 A G 19: 36,958,373 T188A probably benign Het
Btnl6 G A 17: 34,515,531 Q86* probably null Het
C2cd3 T A 7: 100,416,062 L685H probably damaging Het
Cdh23 T C 10: 60,413,173 T878A possibly damaging Het
Clec4b2 T C 6: 123,202,149 Y137H probably damaging Het
Dchs1 T A 7: 105,755,836 T2500S possibly damaging Het
Def6 A G 17: 28,217,092 Y75C probably damaging Het
Dner C T 1: 84,494,893 probably benign Het
Dnmbp G A 19: 43,902,231 P366S probably benign Het
Eif4g3 T C 4: 138,175,848 C1160R possibly damaging Het
Elmod1 G A 9: 53,912,901 probably benign Het
Faah C A 4: 116,004,391 L305F probably damaging Het
Fam71b A G 11: 46,406,804 T312A unknown Het
Flt1 A G 5: 147,571,014 probably benign Het
Fyco1 A T 9: 123,822,406 N1196K probably benign Het
Galnt18 T C 7: 111,554,457 N320S probably damaging Het
Glp2r C A 11: 67,709,712 G437V possibly damaging Het
Gm4884 T C 7: 41,044,292 S562P probably damaging Het
Gm9936 A G 5: 114,857,347 probably benign Het
Gpn2 C A 4: 133,584,792 P112T probably damaging Het
Grm4 A G 17: 27,431,575 Y816H probably benign Het
Helz2 A T 2: 181,240,959 S14T probably benign Het
Htt T C 5: 34,820,104 L778P probably benign Het
Il11ra1 T C 4: 41,765,060 S129P probably damaging Het
Ints11 T C 4: 155,887,168 F315S probably damaging Het
Itga11 A T 9: 62,776,613 N1059Y possibly damaging Het
Jak3 A G 8: 71,684,327 S716G probably damaging Het
Kcns1 G T 2: 164,168,643 D65E probably benign Het
Kdm5d A T Y: 941,715 K1305N probably benign Het
Kif26a G T 12: 112,177,880 V1523L probably benign Het
Mboat7 A G 7: 3,683,822 S340P probably damaging Het
Mctp2 T C 7: 72,229,408 I234V probably benign Het
Mex3c G A 18: 73,590,551 A572T probably benign Het
Mpp3 C A 11: 102,005,425 R424L probably benign Het
Mroh4 T A 15: 74,608,237 probably benign Het
Myo9a A T 9: 59,860,206 probably benign Het
Myog T A 1: 134,290,235 H60Q probably damaging Het
Nlrp9a T A 7: 26,571,225 probably null Het
Notch1 A G 2: 26,473,818 V868A possibly damaging Het
Olfr352 A G 2: 36,870,160 N198S probably damaging Het
Olfr59 T A 11: 74,289,051 I135N possibly damaging Het
Olfr73 T C 2: 88,034,266 Y291C possibly damaging Het
Olfr980 A T 9: 40,006,355 I198N probably damaging Het
Pink1 T C 4: 138,317,401 T342A probably benign Het
Plb1 T A 5: 32,349,615 probably benign Het
Plec T C 15: 76,178,246 D2524G probably damaging Het
Plekhg4 G T 8: 105,375,396 E6* probably null Het
Polq T C 16: 37,061,839 F1455S possibly damaging Het
Ppm1e A G 11: 87,249,058 probably benign Het
Prkaca G A 8: 83,988,303 M119I possibly damaging Het
Prss46 G T 9: 110,850,055 S108I probably damaging Het
Ptma C T 1: 86,529,776 probably benign Het
Rab11fip4 C T 11: 79,689,653 T437M probably benign Het
Rngtt T A 4: 33,379,409 M437K probably benign Het
Rrn3 T A 16: 13,813,113 D604E possibly damaging Het
Scn4a A G 11: 106,348,405 probably benign Het
Sis A G 3: 72,910,476 L1468P possibly damaging Het
Slit3 A G 11: 35,707,918 M1450V probably benign Het
Smg5 T C 3: 88,349,233 S269P probably benign Het
Sntg1 T C 1: 8,463,462 T323A probably damaging Het
Son C T 16: 91,651,662 T37I probably damaging Het
Stk17b T C 1: 53,764,132 I41M probably benign Het
Tgm5 T A 2: 121,076,882 Y120F probably damaging Het
Tppp A G 13: 74,021,360 K73R possibly damaging Het
Ttn C A 2: 76,739,158 K27130N probably damaging Het
Ttn C T 2: 76,907,752 V4148I probably benign Het
Uba7 A T 9: 107,978,249 Y375F probably damaging Het
Ugcg T C 4: 59,213,931 L171P possibly damaging Het
Vsig2 T C 9: 37,542,576 probably benign Het
Zcchc11 T A 4: 108,530,955 probably benign Het
Zfp839 T A 12: 110,868,386 S692T possibly damaging Het
Other mutations in Dhx33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Dhx33 APN 11 71001620 missense probably benign
IGL01357:Dhx33 APN 11 70993861 nonsense probably null
IGL01358:Dhx33 APN 11 70993861 nonsense probably null
IGL01359:Dhx33 APN 11 70993861 nonsense probably null
IGL01360:Dhx33 APN 11 70993861 nonsense probably null
IGL01558:Dhx33 APN 11 70999753 missense probably benign 0.01
IGL02232:Dhx33 APN 11 70987204 missense probably damaging 1.00
IGL02543:Dhx33 APN 11 70987240 missense probably damaging 1.00
R0013:Dhx33 UTSW 11 70993635 missense probably damaging 0.99
R1544:Dhx33 UTSW 11 70999528 missense probably damaging 1.00
R1782:Dhx33 UTSW 11 71001640 missense probably damaging 1.00
R1909:Dhx33 UTSW 11 70989107 missense probably benign 0.02
R2074:Dhx33 UTSW 11 70999843 missense probably damaging 1.00
R3729:Dhx33 UTSW 11 70989152 missense probably benign 0.00
R3731:Dhx33 UTSW 11 70989152 missense probably benign 0.00
R5902:Dhx33 UTSW 11 70989131 missense probably damaging 1.00
R7129:Dhx33 UTSW 11 70993863 missense probably damaging 1.00
R7605:Dhx33 UTSW 11 70999473 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCCCTGCACAAAGCACTATAAC -3'
(R):5'- TGGCATCTGCTACCGACTCTACAC -3'

Sequencing Primer
(F):5'- TGCACAAAGCACTATAACATGGAATC -3'
(R):5'- CTCTACACTGAGGACGAGTTTGAG -3'
Posted On2013-05-09