Incidental Mutation 'R4400:Zranb3'
Institutional Source Beutler Lab
Gene Symbol Zranb3
Ensembl Gene ENSMUSG00000036086
Gene Namezinc finger, RAN-binding domain containing 3
MMRRC Submission 041131-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R4400 (G1)
Quality Score225
Status Not validated
Chromosomal Location127954184-128103047 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 127956655 bp
Amino Acid Change Leucine to Arginine at position 998 (L998R)
Ref Sequence ENSEMBL: ENSMUSP00000108157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086614] [ENSMUST00000112538]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086614
AA Change: L998R

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000083806
Gene: ENSMUSG00000036086
AA Change: L998R

DEXDc 33 214 3.37e-19 SMART
HELICc 352 435 3.79e-13 SMART
ZnF_RBZ 619 643 6.93e-5 SMART
HNHc 985 1036 5.64e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112538
AA Change: L998R

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108157
Gene: ENSMUSG00000036086
AA Change: L998R

Pfam:SNF2_N 40 98 6.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186230
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp4b A G 8: 13,388,810 F189L probably damaging Het
Atp8a1 A T 5: 67,764,878 Y372N probably benign Het
Bves T C 10: 45,369,293 V354A probably benign Het
Cd79b A T 11: 106,312,010 Y195* probably null Het
Cog6 A C 3: 53,012,941 D131E probably benign Het
Elp3 C T 14: 65,548,090 E421K possibly damaging Het
Fbxw28 A T 9: 109,328,310 F237Y probably damaging Het
Fezf1 T C 6: 23,247,710 N122S probably benign Het
Galnt2 A G 8: 124,324,303 K157E probably damaging Het
Git2 T C 5: 114,733,909 E141G possibly damaging Het
Gm26888 T C 11: 119,154,027 silent Het
Gnrhr T C 5: 86,182,249 probably null Het
Hoxd13 A T 2: 74,670,015 D300V probably damaging Het
Hspg2 G A 4: 137,548,122 A2748T probably benign Het
Hyal2 A G 9: 107,570,853 N235S probably damaging Het
Itgam T G 7: 128,081,658 L253R probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Matr3 A T 18: 35,583,916 K591N possibly damaging Het
Mep1a T A 17: 43,475,006 I731F possibly damaging Het
Mkl1 G A 15: 81,020,923 Q103* probably null Het
Muc5b A G 7: 141,861,387 D2690G possibly damaging Het
Nlrc5 A G 8: 94,494,353 Q1140R probably benign Het
Olfr205 C T 16: 59,328,598 V304I probably benign Het
Olfr292 A G 7: 86,694,590 I45V probably benign Het
Olfr711 A G 7: 106,972,002 L114P probably damaging Het
Plcl1 T C 1: 55,715,577 F1028L probably damaging Het
Plpp2 A G 10: 79,527,493 V106A possibly damaging Het
Prpf8 A G 11: 75,490,702 T255A possibly damaging Het
Shoc2 A G 19: 54,031,229 I568V probably benign Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Ssrp1 A T 2: 85,037,941 D9V probably damaging Het
Strn3 A T 12: 51,648,100 D293E possibly damaging Het
Tbx3 G T 5: 119,680,571 D404Y probably damaging Het
Tdrd7 T C 4: 46,005,540 S416P possibly damaging Het
Trim60 G T 8: 65,001,212 Y128* probably null Het
Tspoap1 T C 11: 87,775,603 S947P probably damaging Het
Ttn A T 2: 76,782,395 S17113R probably damaging Het
Ubqln1 T A 13: 58,193,388 N183I probably damaging Het
Ubr4 A G 4: 139,461,856 N3917D possibly damaging Het
Ucp2 A G 7: 100,499,350 *310W probably null Het
Wdr76 A G 2: 121,528,833 M218V probably damaging Het
Zxdc G A 6: 90,369,810 G51E probably damaging Het
Other mutations in Zranb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Zranb3 APN 1 128016140 missense probably benign 0.01
IGL00818:Zranb3 APN 1 128032867 missense probably damaging 1.00
IGL01360:Zranb3 APN 1 127959885 nonsense probably null
IGL01704:Zranb3 APN 1 127967939 missense possibly damaging 0.93
IGL02131:Zranb3 APN 1 127992951 missense probably damaging 1.00
IGL02466:Zranb3 APN 1 128016092 missense probably benign 0.08
IGL02825:Zranb3 APN 1 127959752 missense probably benign 0.13
IGL02836:Zranb3 APN 1 127960825 missense probably benign 0.00
R0088:Zranb3 UTSW 1 127976462 missense probably benign
R0279:Zranb3 UTSW 1 127963773 missense probably benign 0.01
R0423:Zranb3 UTSW 1 128091870 missense probably damaging 1.00
R0499:Zranb3 UTSW 1 127955080 splice site probably null
R0562:Zranb3 UTSW 1 128036558 missense probably benign 0.04
R0972:Zranb3 UTSW 1 127956646 missense probably damaging 1.00
R1480:Zranb3 UTSW 1 128091862 missense probably damaging 1.00
R1552:Zranb3 UTSW 1 127960751 splice site probably benign
R1704:Zranb3 UTSW 1 128092003 start codon destroyed probably null 0.22
R1817:Zranb3 UTSW 1 128017556 critical splice donor site probably null
R1818:Zranb3 UTSW 1 128017556 critical splice donor site probably null
R1819:Zranb3 UTSW 1 128017556 critical splice donor site probably null
R1951:Zranb3 UTSW 1 127999399 missense probably damaging 1.00
R1953:Zranb3 UTSW 1 127999399 missense probably damaging 1.00
R1988:Zranb3 UTSW 1 127959743 missense probably benign
R2011:Zranb3 UTSW 1 128091901 missense probably benign 0.00
R3159:Zranb3 UTSW 1 127972949 missense probably benign
R4179:Zranb3 UTSW 1 127960864 missense possibly damaging 0.88
R4281:Zranb3 UTSW 1 127963877 missense possibly damaging 0.69
R5236:Zranb3 UTSW 1 128040989 missense probably damaging 1.00
R5330:Zranb3 UTSW 1 127959720 missense probably damaging 0.99
R5719:Zranb3 UTSW 1 127963876 missense probably benign 0.00
R6125:Zranb3 UTSW 1 127959745 missense probably benign
R6220:Zranb3 UTSW 1 127999404 missense probably benign 0.44
R6414:Zranb3 UTSW 1 128040957 missense probably benign 0.08
R6751:Zranb3 UTSW 1 127959819 missense probably benign
R7229:Zranb3 UTSW 1 128040893 missense probably benign 0.00
R7419:Zranb3 UTSW 1 127963851 missense possibly damaging 0.86
R7537:Zranb3 UTSW 1 128032847 critical splice donor site probably null
R7771:Zranb3 UTSW 1 128032868 missense probably damaging 1.00
R7980:Zranb3 UTSW 1 128102934 unclassified probably benign
R8152:Zranb3 UTSW 1 127954995 missense probably damaging 1.00
R8370:Zranb3 UTSW 1 127967933 missense probably benign 0.00
R8458:Zranb3 UTSW 1 127992910 missense probably damaging 1.00
R8816:Zranb3 UTSW 1 128036610 missense possibly damaging 0.95
Z1176:Zranb3 UTSW 1 127965148 missense possibly damaging 0.55
Z1176:Zranb3 UTSW 1 128036481 missense probably benign 0.25
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-07-07