Incidental Mutation 'R4400:Hoxd13'
ID 326569
Institutional Source Beutler Lab
Gene Symbol Hoxd13
Ensembl Gene ENSMUSG00000001819
Gene Name homeobox D13
Synonyms Hox-4.8, spdh
MMRRC Submission 041131-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.559) question?
Stock # R4400 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 74668310-74671599 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 74670015 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 300 (D300V)
Ref Sequence ENSEMBL: ENSMUSP00000001872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001872] [ENSMUST00000001878]
AlphaFold P70217
Predicted Effect probably damaging
Transcript: ENSMUST00000001872
AA Change: D300V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001872
Gene: ENSMUSG00000001819
AA Change: D300V

low complexity region 14 34 N/A INTRINSIC
Pfam:HoxA13_N 75 177 4e-18 PFAM
HOX 272 334 4.33e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000001878
SMART Domains Protein: ENSMUSP00000001878
Gene: ENSMUSG00000001823

HOX 200 262 4.57e-21 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located in a cluster on chromosome 2. Deletions that remove the entire HOXD gene cluster or the 5' end of this cluster have been associated with severe limb and genital abnormalities. Mutations in this particular gene cause synpolydactyly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted and spontaneous mutations exhibit abnormalities of the axial skeleton, especially limbs, and of the male accessory organs, and agenesis of the preputial glands. Mutant males are sterile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp4b A G 8: 13,388,810 F189L probably damaging Het
Atp8a1 A T 5: 67,764,878 Y372N probably benign Het
Bves T C 10: 45,369,293 V354A probably benign Het
Cd79b A T 11: 106,312,010 Y195* probably null Het
Cog6 A C 3: 53,012,941 D131E probably benign Het
Elp3 C T 14: 65,548,090 E421K possibly damaging Het
Fbxw28 A T 9: 109,328,310 F237Y probably damaging Het
Fezf1 T C 6: 23,247,710 N122S probably benign Het
Galnt2 A G 8: 124,324,303 K157E probably damaging Het
Git2 T C 5: 114,733,909 E141G possibly damaging Het
Gm26888 T C 11: 119,154,027 silent Het
Gnrhr T C 5: 86,182,249 probably null Het
Hspg2 G A 4: 137,548,122 A2748T probably benign Het
Hyal2 A G 9: 107,570,853 N235S probably damaging Het
Itgam T G 7: 128,081,658 L253R probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Matr3 A T 18: 35,583,916 K591N possibly damaging Het
Mep1a T A 17: 43,475,006 I731F possibly damaging Het
Mkl1 G A 15: 81,020,923 Q103* probably null Het
Muc5b A G 7: 141,861,387 D2690G possibly damaging Het
Nlrc5 A G 8: 94,494,353 Q1140R probably benign Het
Olfr205 C T 16: 59,328,598 V304I probably benign Het
Olfr292 A G 7: 86,694,590 I45V probably benign Het
Olfr711 A G 7: 106,972,002 L114P probably damaging Het
Plcl1 T C 1: 55,715,577 F1028L probably damaging Het
Plpp2 A G 10: 79,527,493 V106A possibly damaging Het
Prpf8 A G 11: 75,490,702 T255A possibly damaging Het
Shoc2 A G 19: 54,031,229 I568V probably benign Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Ssrp1 A T 2: 85,037,941 D9V probably damaging Het
Strn3 A T 12: 51,648,100 D293E possibly damaging Het
Tbx3 G T 5: 119,680,571 D404Y probably damaging Het
Tdrd7 T C 4: 46,005,540 S416P possibly damaging Het
Trim60 G T 8: 65,001,212 Y128* probably null Het
Tspoap1 T C 11: 87,775,603 S947P probably damaging Het
Ttn A T 2: 76,782,395 S17113R probably damaging Het
Ubqln1 T A 13: 58,193,388 N183I probably damaging Het
Ubr4 A G 4: 139,461,856 N3917D possibly damaging Het
Ucp2 A G 7: 100,499,350 *310W probably null Het
Wdr76 A G 2: 121,528,833 M218V probably damaging Het
Zranb3 A C 1: 127,956,655 L998R possibly damaging Het
Zxdc G A 6: 90,369,810 G51E probably damaging Het
Other mutations in Hoxd13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03108:Hoxd13 APN 2 74670096 missense probably damaging 1.00
R1722:Hoxd13 UTSW 2 74670045 missense probably benign 0.34
R2163:Hoxd13 UTSW 2 74669069 missense possibly damaging 0.82
R4116:Hoxd13 UTSW 2 74668488 missense possibly damaging 0.93
R4424:Hoxd13 UTSW 2 74669957 nonsense probably null
R4938:Hoxd13 UTSW 2 74668683 missense probably benign 0.26
R5535:Hoxd13 UTSW 2 74668797 missense probably damaging 0.99
R7054:Hoxd13 UTSW 2 74669025 missense probably damaging 1.00
R7069:Hoxd13 UTSW 2 74669024 missense probably damaging 1.00
R7677:Hoxd13 UTSW 2 74668565 missense probably benign 0.39
R8329:Hoxd13 UTSW 2 74668317 missense probably benign 0.06
R8906:Hoxd13 UTSW 2 74669922 missense
R9130:Hoxd13 UTSW 2 74669038 missense probably benign 0.02
R9386:Hoxd13 UTSW 2 74668983 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2015-07-07