Mutagenetix > Incidental Mutations

Incidental Mutation 'R4400:Ssrp1'

326571

Institutional Source

Beutler Lab

Gene Symbol

Ssrp1

Ensembl Gene

ENSMUSG00000027067

Gene Name

structure specific recognition protein 1

Synonyms

Hmgi-rs3, T160, Hmgox, Hmg1-rs1

MMRRC Submission

041131-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4400 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

85037234-85047109 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 85037941 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 9 (D9V)

Ref Sequence

ENSEMBL: ENSMUSP00000127058 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028465] [ENSMUST00000077798] [ENSMUST00000111613] [ENSMUST00000111616] [ENSMUST00000130729] [ENSMUST00000168266]

Predicted Effect

probably benign
Transcript: ENSMUST00000028465

SMART Domains

Protein: ENSMUSP00000028465
Gene: ENSMUSG00000027071

Domain	Start	End	E-Value	Type
Pfam:P2X_receptor	8	367	1.6e-151	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000077798
AA Change: D9V

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000076971
Gene: ENSMUSG00000027067
AA Change: D9V

Domain	Start	End	E-Value	Type
Pfam:SSrecog	74	285	1.7e-105	PFAM
Rtt106	338	428	4.76e-41	SMART
low complexity region	469	481	N/A	INTRINSIC
low complexity region	486	514	N/A	INTRINSIC
low complexity region	521	542	N/A	INTRINSIC
HMG	546	616	1.9e-27	SMART
low complexity region	621	691	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000111613

SMART Domains

Protein: ENSMUSP00000107240
Gene: ENSMUSG00000027071

Domain	Start	End	E-Value	Type
Pfam:P2X_receptor	8	372	4.7e-162	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111616

SMART Domains

Protein: ENSMUSP00000107243
Gene: ENSMUSG00000027071

Domain	Start	End	E-Value	Type
Pfam:P2X_receptor	8	91	1.2e-32	PFAM
Pfam:P2X_receptor	86	350	3.3e-113	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123467

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127839

Predicted Effect

possibly damaging
Transcript: ENSMUST00000130729
AA Change: D9V

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000121639
Gene: ENSMUSG00000027067
AA Change: D9V

Domain	Start	End	E-Value	Type
Pfam:SSrecog	74	285	5.7e-106	PFAM
Rtt106	338	428	4.76e-41	SMART
low complexity region	469	481	N/A	INTRINSIC
low complexity region	486	514	N/A	INTRINSIC
low complexity region	521	542	N/A	INTRINSIC
HMG	546	616	1.9e-27	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135414

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142359

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145285

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146530

Predicted Effect

probably damaging
Transcript: ENSMUST00000168266
AA Change: D9V

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000127058
Gene: ENSMUSG00000027067
AA Change: D9V

Domain	Start	End	E-Value	Type
Pfam:SSrecog	75	284	8.8e-91	PFAM
Rtt106	338	428	4.76e-41	SMART
low complexity region	469	481	N/A	INTRINSIC
low complexity region	486	514	N/A	INTRINSIC
low complexity region	521	542	N/A	INTRINSIC
HMG	546	616	1.9e-27	SMART
low complexity region	621	691	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.0%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of a heterodimer that, along with SUPT16H, forms chromatin transcriptional elongation factor FACT. FACT interacts specifically with histones H2A/H2B to effect nucleosome disassembly and transcription elongation. FACT and cisplatin-damaged DNA may be crucial to the anticancer mechanism of cisplatin. This encoded protein contains a high mobility group box which most likely constitutes the structure recognition element for cisplatin-modified DNA. This protein also functions as a co-activator of the transcriptional activator p63. An alternatively spliced transcript variant of this gene has been described, but its full-length nature is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this gene is lethal resulting in death at some point between implantation and E5.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp4b	A	G	8: 13,388,810	F189L	probably damaging	Het
Atp8a1	A	T	5: 67,764,878	Y372N	probably benign	Het
Bves	T	C	10: 45,369,293	V354A	probably benign	Het
Cd79b	A	T	11: 106,312,010	Y195*	probably null	Het
Cog6	A	C	3: 53,012,941	D131E	probably benign	Het
Elp3	C	T	14: 65,548,090	E421K	possibly damaging	Het
Fbxw28	A	T	9: 109,328,310	F237Y	probably damaging	Het
Fezf1	T	C	6: 23,247,710	N122S	probably benign	Het
Galnt2	A	G	8: 124,324,303	K157E	probably damaging	Het
Git2	T	C	5: 114,733,909	E141G	possibly damaging	Het
Gm26888	T	C	11: 119,154,027		silent	Het
Gnrhr	T	C	5: 86,182,249		probably null	Het
Hoxd13	A	T	2: 74,670,015	D300V	probably damaging	Het
Hspg2	G	A	4: 137,548,122	A2748T	probably benign	Het
Hyal2	A	G	9: 107,570,853	N235S	probably damaging	Het
Itgam	T	G	7: 128,081,658	L253R	probably damaging	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906		probably benign	Het
Matr3	A	T	18: 35,583,916	K591N	possibly damaging	Het
Mep1a	T	A	17: 43,475,006	I731F	possibly damaging	Het
Mkl1	G	A	15: 81,020,923	Q103*	probably null	Het
Muc5b	A	G	7: 141,861,387	D2690G	possibly damaging	Het
Nlrc5	A	G	8: 94,494,353	Q1140R	probably benign	Het
Olfr205	C	T	16: 59,328,598	V304I	probably benign	Het
Olfr292	A	G	7: 86,694,590	I45V	probably benign	Het
Olfr711	A	G	7: 106,972,002	L114P	probably damaging	Het
Plcl1	T	C	1: 55,715,577	F1028L	probably damaging	Het
Plpp2	A	G	10: 79,527,493	V106A	possibly damaging	Het
Prpf8	A	G	11: 75,490,702	T255A	possibly damaging	Het
Shoc2	A	G	19: 54,031,229	I568V	probably benign	Het
Spopl	C	T	2: 23,517,945	V241M	probably damaging	Het
Strn3	A	T	12: 51,648,100	D293E	possibly damaging	Het
Tbx3	G	T	5: 119,680,571	D404Y	probably damaging	Het
Tdrd7	T	C	4: 46,005,540	S416P	possibly damaging	Het
Trim60	G	T	8: 65,001,212	Y128*	probably null	Het
Tspoap1	T	C	11: 87,775,603	S947P	probably damaging	Het
Ttn	A	T	2: 76,782,395	S17113R	probably damaging	Het
Ubqln1	T	A	13: 58,193,388	N183I	probably damaging	Het
Ubr4	A	G	4: 139,461,856	N3917D	possibly damaging	Het
Ucp2	A	G	7: 100,499,350	*310W	probably null	Het
Wdr76	A	G	2: 121,528,833	M218V	probably damaging	Het
Zranb3	A	C	1: 127,956,655	L998R	possibly damaging	Het
Zxdc	G	A	6: 90,369,810	G51E	probably damaging	Het

Other mutations in Ssrp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01636:Ssrp1	APN	2	85041099	splice site	probably benign
IGL01935:Ssrp1	APN	2	85046712	makesense	probably null
IGL02226:Ssrp1	APN	2	85040361	missense	probably damaging	1.00
IGL02793:Ssrp1	APN	2	85040920	missense	probably damaging	1.00
IGL02875:Ssrp1	APN	2	85040920	missense	probably damaging	1.00
Dickcissel	UTSW	2	85041634	missense	probably damaging	0.96
Meadowlark	UTSW	2	85041106	critical splice acceptor site	probably null
PIT4131001:Ssrp1	UTSW	2	85038416	missense	probably damaging	1.00
R0313:Ssrp1	UTSW	2	85041554	missense	probably damaging	1.00
R0363:Ssrp1	UTSW	2	85040674	missense	probably damaging	0.99
R1234:Ssrp1	UTSW	2	85042263	missense	probably damaging	1.00
R1643:Ssrp1	UTSW	2	85041185	missense	possibly damaging	0.89
R1713:Ssrp1	UTSW	2	85040760	missense	probably damaging	0.99
R2049:Ssrp1	UTSW	2	85041427	splice site	probably benign
R2113:Ssrp1	UTSW	2	85043006	splice site	probably null
R2291:Ssrp1	UTSW	2	85042316	critical splice donor site	probably null
R2471:Ssrp1	UTSW	2	85042298	missense	possibly damaging	0.95
R2965:Ssrp1	UTSW	2	85041586	missense	possibly damaging	0.46
R3552:Ssrp1	UTSW	2	85044392	missense	probably benign
R4060:Ssrp1	UTSW	2	85041634	missense	probably damaging	0.96
R4075:Ssrp1	UTSW	2	85045568	missense	possibly damaging	0.68
R4131:Ssrp1	UTSW	2	85044447	missense	probably null	0.28
R4326:Ssrp1	UTSW	2	85040217	intron	probably benign
R4357:Ssrp1	UTSW	2	85041151	missense	probably benign	0.22
R4797:Ssrp1	UTSW	2	85045722	nonsense	probably null
R5293:Ssrp1	UTSW	2	85042252	nonsense	probably null
R5571:Ssrp1	UTSW	2	85044325	missense	probably damaging	0.99
R5592:Ssrp1	UTSW	2	85045519	missense	probably benign	0.00
R5743:Ssrp1	UTSW	2	85041168	nonsense	probably null
R5991:Ssrp1	UTSW	2	85042296	missense	possibly damaging	0.94
R6019:Ssrp1	UTSW	2	85045452	missense	probably damaging	1.00
R6133:Ssrp1	UTSW	2	85045339	intron	probably benign
R6157:Ssrp1	UTSW	2	85040728	missense	probably damaging	0.99
R6225:Ssrp1	UTSW	2	85042814	missense	probably benign	0.02
R6551:Ssrp1	UTSW	2	85041106	critical splice acceptor site	probably null
R6886:Ssrp1	UTSW	2	85039936	missense	probably benign	0.04
R7189:Ssrp1	UTSW	2	85045562	missense	probably benign	0.00
R7681:Ssrp1	UTSW	2	85045748	missense	probably benign
R7789:Ssrp1	UTSW	2	85041181	missense	probably damaging	1.00
X0023:Ssrp1	UTSW	2	85045475	missense	probably benign	0.06
Z1088:Ssrp1	UTSW	2	85040653	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGACATACCAGGTACATGGC -3'
(R):5'- TTGCAACTCTTTGAGACTTTGC -3'

Sequencing Primer
(F):5'- CATACCAGGTACATGGCTGAGC -3'
(R):5'- GCAACTCTTTGAGACTTTGCTCACG -3'

Posted On

2015-07-07