Incidental Mutation 'R4400:Wdr76'
ID326572
Institutional Source Beutler Lab
Gene Symbol Wdr76
Ensembl Gene ENSMUSG00000027242
Gene NameWD repeat domain 76
Synonyms5830411K18Rik
MMRRC Submission 041131-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R4400 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location121506723-121544860 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121528833 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 218 (M218V)
Ref Sequence ENSEMBL: ENSMUSP00000097072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028676] [ENSMUST00000099473] [ENSMUST00000110602] [ENSMUST00000110603]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028676
AA Change: M202V

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028676
Gene: ENSMUSG00000027242
AA Change: M202V

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 40 49 N/A INTRINSIC
low complexity region 93 109 N/A INTRINSIC
low complexity region 137 154 N/A INTRINSIC
WD40 205 244 8.59e-1 SMART
WD40 249 289 1.63e-4 SMART
WD40 292 331 1.98e1 SMART
WD40 336 375 4.75e1 SMART
WD40 383 423 9.24e-4 SMART
low complexity region 424 435 N/A INTRINSIC
WD40 479 520 2.28e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099473
AA Change: M218V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097072
Gene: ENSMUSG00000027242
AA Change: M218V

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 40 49 N/A INTRINSIC
low complexity region 109 125 N/A INTRINSIC
low complexity region 153 170 N/A INTRINSIC
WD40 221 260 8.59e-1 SMART
WD40 265 305 1.63e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110602
AA Change: M202V

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106232
Gene: ENSMUSG00000027242
AA Change: M202V

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 40 49 N/A INTRINSIC
low complexity region 93 109 N/A INTRINSIC
low complexity region 137 154 N/A INTRINSIC
WD40 205 244 8.59e-1 SMART
WD40 249 289 1.63e-4 SMART
WD40 292 331 1.98e1 SMART
WD40 336 375 4.75e1 SMART
WD40 383 423 9.24e-4 SMART
low complexity region 424 435 N/A INTRINSIC
WD40 479 520 2.28e2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110603
AA Change: M300V

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106234
Gene: ENSMUSG00000027242
AA Change: M300V

DomainStartEndE-ValueType
low complexity region 56 94 N/A INTRINSIC
low complexity region 97 114 N/A INTRINSIC
low complexity region 138 147 N/A INTRINSIC
low complexity region 191 207 N/A INTRINSIC
low complexity region 235 252 N/A INTRINSIC
WD40 303 342 8.59e-1 SMART
WD40 347 387 1.63e-4 SMART
WD40 390 429 1.98e1 SMART
WD40 434 473 4.75e1 SMART
WD40 481 521 9.24e-4 SMART
low complexity region 522 533 N/A INTRINSIC
WD40 577 618 2.28e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132373
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp4b A G 8: 13,388,810 F189L probably damaging Het
Atp8a1 A T 5: 67,764,878 Y372N probably benign Het
Bves T C 10: 45,369,293 V354A probably benign Het
Cd79b A T 11: 106,312,010 Y195* probably null Het
Cog6 A C 3: 53,012,941 D131E probably benign Het
Elp3 C T 14: 65,548,090 E421K possibly damaging Het
Fbxw28 A T 9: 109,328,310 F237Y probably damaging Het
Fezf1 T C 6: 23,247,710 N122S probably benign Het
Galnt2 A G 8: 124,324,303 K157E probably damaging Het
Git2 T C 5: 114,733,909 E141G possibly damaging Het
Gm26888 T C 11: 119,154,027 silent Het
Gnrhr T C 5: 86,182,249 probably null Het
Hoxd13 A T 2: 74,670,015 D300V probably damaging Het
Hspg2 G A 4: 137,548,122 A2748T probably benign Het
Hyal2 A G 9: 107,570,853 N235S probably damaging Het
Itgam T G 7: 128,081,658 L253R probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Matr3 A T 18: 35,583,916 K591N possibly damaging Het
Mep1a T A 17: 43,475,006 I731F possibly damaging Het
Mkl1 G A 15: 81,020,923 Q103* probably null Het
Muc5b A G 7: 141,861,387 D2690G possibly damaging Het
Nlrc5 A G 8: 94,494,353 Q1140R probably benign Het
Olfr205 C T 16: 59,328,598 V304I probably benign Het
Olfr292 A G 7: 86,694,590 I45V probably benign Het
Olfr711 A G 7: 106,972,002 L114P probably damaging Het
Plcl1 T C 1: 55,715,577 F1028L probably damaging Het
Plpp2 A G 10: 79,527,493 V106A possibly damaging Het
Prpf8 A G 11: 75,490,702 T255A possibly damaging Het
Shoc2 A G 19: 54,031,229 I568V probably benign Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Ssrp1 A T 2: 85,037,941 D9V probably damaging Het
Strn3 A T 12: 51,648,100 D293E possibly damaging Het
Tbx3 G T 5: 119,680,571 D404Y probably damaging Het
Tdrd7 T C 4: 46,005,540 S416P possibly damaging Het
Trim60 G T 8: 65,001,212 Y128* probably null Het
Tspoap1 T C 11: 87,775,603 S947P probably damaging Het
Ttn A T 2: 76,782,395 S17113R probably damaging Het
Ubqln1 T A 13: 58,193,388 N183I probably damaging Het
Ubr4 A G 4: 139,461,856 N3917D possibly damaging Het
Ucp2 A G 7: 100,499,350 *310W probably null Het
Zranb3 A C 1: 127,956,655 L998R possibly damaging Het
Zxdc G A 6: 90,369,810 G51E probably damaging Het
Other mutations in Wdr76
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Wdr76 APN 2 121535497 missense probably benign 0.11
IGL01930:Wdr76 APN 2 121510822 missense possibly damaging 0.82
IGL03166:Wdr76 APN 2 121534306 missense possibly damaging 0.76
IGL03242:Wdr76 APN 2 121542470 missense probably damaging 0.98
R0048:Wdr76 UTSW 2 121535419 splice site probably benign
R0048:Wdr76 UTSW 2 121535419 splice site probably benign
R0049:Wdr76 UTSW 2 121519451 missense probably damaging 1.00
R1575:Wdr76 UTSW 2 121528921 missense probably damaging 1.00
R4825:Wdr76 UTSW 2 121542494 missense probably benign 0.25
R5622:Wdr76 UTSW 2 121517735 missense probably damaging 1.00
R5895:Wdr76 UTSW 2 121528842 missense probably damaging 1.00
R6349:Wdr76 UTSW 2 121534231 missense possibly damaging 0.45
R7229:Wdr76 UTSW 2 121528920 missense probably damaging 0.99
R8302:Wdr76 UTSW 2 121510563 missense probably benign
R8439:Wdr76 UTSW 2 121510698 missense possibly damaging 0.73
R8466:Wdr76 UTSW 2 121510557 missense probably damaging 1.00
R8791:Wdr76 UTSW 2 121527003 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACCTGGGAGTTGGATATTTGCC -3'
(R):5'- CCGTCAGGCAGACTTCAGATAAC -3'

Sequencing Primer
(F):5'- CAAGACAGGGTTTCTCTGTGTAGC -3'
(R):5'- GGCAGACTTCAGATAACTTCCAAAAG -3'
Posted On2015-07-07