Incidental Mutation 'R4400:Atp8a1'
ID326578
Institutional Source Beutler Lab
Gene Symbol Atp8a1
Ensembl Gene ENSMUSG00000037685
Gene NameATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1
SynonymsB230107D19Rik, Atp3a2
MMRRC Submission 041131-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4400 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location67618140-67847434 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67764878 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 372 (Y372N)
Ref Sequence ENSEMBL: ENSMUSP00000042215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037380] [ENSMUST00000072971] [ENSMUST00000135930] [ENSMUST00000200955]
Predicted Effect probably benign
Transcript: ENSMUST00000037380
AA Change: Y372N

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000042215
Gene: ENSMUSG00000037685
AA Change: Y372N

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 101 9.8e-27 PFAM
Pfam:E1-E2_ATPase 106 371 3e-11 PFAM
Pfam:HAD 406 810 3.8e-23 PFAM
Pfam:Cation_ATPase 485 585 6e-14 PFAM
Pfam:PhoLip_ATPase_C 827 1079 8.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072971
AA Change: Y372N

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000072738
Gene: ENSMUSG00000037685
AA Change: Y372N

DomainStartEndE-ValueType
Pfam:E1-E2_ATPase 104 375 2.1e-22 PFAM
Pfam:Hydrolase 403 798 2.2e-14 PFAM
Pfam:HAD 406 795 3e-18 PFAM
Pfam:Hydrolase_like2 470 570 4.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135930
AA Change: Y372N

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000118379
Gene: ENSMUSG00000037685
AA Change: Y372N

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 101 1.1e-26 PFAM
Pfam:E1-E2_ATPase 106 371 8.6e-14 PFAM
Pfam:HAD 406 795 3.6e-23 PFAM
Pfam:Cation_ATPase 470 570 1.2e-13 PFAM
Pfam:PhoLip_ATPase_C 812 1064 8.4e-82 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152433
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155911
Predicted Effect probably benign
Transcript: ENSMUST00000200955
AA Change: Y372N

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000144465
Gene: ENSMUSG00000037685
AA Change: Y372N

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 101 7.5e-25 PFAM
Pfam:E1-E2_ATPase 106 371 3.7e-13 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The P-type adenosinetriphosphatases (P-type ATPases) are a family of proteins which use the free energy of ATP hydrolysis to drive uphill transport of ions across membranes. Several subfamilies of P-type ATPases have been identified. One subfamily catalyzes transport of heavy metal ions. Another subfamily transports non-heavy metal ions (NMHI). The protein encoded by this gene is a member of the third subfamily of P-type ATPases and acts to transport amphipaths, such as phosphatidylserine. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable, fertile and phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp4b A G 8: 13,388,810 F189L probably damaging Het
Bves T C 10: 45,369,293 V354A probably benign Het
Cd79b A T 11: 106,312,010 Y195* probably null Het
Cog6 A C 3: 53,012,941 D131E probably benign Het
Elp3 C T 14: 65,548,090 E421K possibly damaging Het
Fbxw28 A T 9: 109,328,310 F237Y probably damaging Het
Fezf1 T C 6: 23,247,710 N122S probably benign Het
Galnt2 A G 8: 124,324,303 K157E probably damaging Het
Git2 T C 5: 114,733,909 E141G possibly damaging Het
Gm26888 T C 11: 119,154,027 silent Het
Gnrhr T C 5: 86,182,249 probably null Het
Hoxd13 A T 2: 74,670,015 D300V probably damaging Het
Hspg2 G A 4: 137,548,122 A2748T probably benign Het
Hyal2 A G 9: 107,570,853 N235S probably damaging Het
Itgam T G 7: 128,081,658 L253R probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Matr3 A T 18: 35,583,916 K591N possibly damaging Het
Mep1a T A 17: 43,475,006 I731F possibly damaging Het
Mkl1 G A 15: 81,020,923 Q103* probably null Het
Muc5b A G 7: 141,861,387 D2690G possibly damaging Het
Nlrc5 A G 8: 94,494,353 Q1140R probably benign Het
Olfr205 C T 16: 59,328,598 V304I probably benign Het
Olfr292 A G 7: 86,694,590 I45V probably benign Het
Olfr711 A G 7: 106,972,002 L114P probably damaging Het
Plcl1 T C 1: 55,715,577 F1028L probably damaging Het
Plpp2 A G 10: 79,527,493 V106A possibly damaging Het
Prpf8 A G 11: 75,490,702 T255A possibly damaging Het
Shoc2 A G 19: 54,031,229 I568V probably benign Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Ssrp1 A T 2: 85,037,941 D9V probably damaging Het
Strn3 A T 12: 51,648,100 D293E possibly damaging Het
Tbx3 G T 5: 119,680,571 D404Y probably damaging Het
Tdrd7 T C 4: 46,005,540 S416P possibly damaging Het
Trim60 G T 8: 65,001,212 Y128* probably null Het
Tspoap1 T C 11: 87,775,603 S947P probably damaging Het
Ttn A T 2: 76,782,395 S17113R probably damaging Het
Ubqln1 T A 13: 58,193,388 N183I probably damaging Het
Ubr4 A G 4: 139,461,856 N3917D possibly damaging Het
Ucp2 A G 7: 100,499,350 *310W probably null Het
Wdr76 A G 2: 121,528,833 M218V probably damaging Het
Zranb3 A C 1: 127,956,655 L998R possibly damaging Het
Zxdc G A 6: 90,369,810 G51E probably damaging Het
Other mutations in Atp8a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Atp8a1 APN 5 67749143 missense probably benign 0.20
IGL00778:Atp8a1 APN 5 67659903 missense possibly damaging 0.58
IGL01068:Atp8a1 APN 5 67667337 missense probably benign 0.02
IGL01152:Atp8a1 APN 5 67847206 missense probably damaging 0.99
IGL01572:Atp8a1 APN 5 67667651 missense probably benign
IGL01608:Atp8a1 APN 5 67813136 nonsense probably null
IGL02171:Atp8a1 APN 5 67738465 missense probably damaging 1.00
IGL02330:Atp8a1 APN 5 67813177 missense probably damaging 0.98
IGL02381:Atp8a1 APN 5 67705995 missense probably benign
IGL02420:Atp8a1 APN 5 67682783 missense probably damaging 1.00
IGL02440:Atp8a1 APN 5 67667434 splice site probably benign
IGL02598:Atp8a1 APN 5 67682756 critical splice donor site probably null
IGL03259:Atp8a1 APN 5 67624006 splice site probably null
IGL03336:Atp8a1 APN 5 67729807 nonsense probably null
IGL03380:Atp8a1 APN 5 67732186 missense probably benign 0.25
PIT4131001:Atp8a1 UTSW 5 67622602 nonsense probably null
PIT4445001:Atp8a1 UTSW 5 67622660 missense
R0208:Atp8a1 UTSW 5 67774721 critical splice donor site probably null
R0276:Atp8a1 UTSW 5 67786673 splice site probably benign
R0279:Atp8a1 UTSW 5 67813092 splice site probably null
R0329:Atp8a1 UTSW 5 67812073 splice site probably benign
R0603:Atp8a1 UTSW 5 67756696 critical splice acceptor site probably null
R0715:Atp8a1 UTSW 5 67774725 missense probably benign 0.00
R0763:Atp8a1 UTSW 5 67659883 missense probably benign
R1296:Atp8a1 UTSW 5 67622706 splice site probably benign
R1631:Atp8a1 UTSW 5 67749052 splice site probably null
R1764:Atp8a1 UTSW 5 67631567 missense probably benign 0.14
R1771:Atp8a1 UTSW 5 67647731 missense probably damaging 1.00
R1885:Atp8a1 UTSW 5 67747318 missense possibly damaging 0.82
R1897:Atp8a1 UTSW 5 67738429 missense probably damaging 1.00
R1968:Atp8a1 UTSW 5 67667657 missense probably benign 0.05
R2965:Atp8a1 UTSW 5 67647706 missense probably benign 0.28
R2966:Atp8a1 UTSW 5 67647706 missense probably benign 0.28
R4247:Atp8a1 UTSW 5 67667574 missense probably damaging 1.00
R4353:Atp8a1 UTSW 5 67769108 missense probably damaging 1.00
R4426:Atp8a1 UTSW 5 67774828 missense probably benign 0.22
R4523:Atp8a1 UTSW 5 67667600 missense probably benign 0.00
R4576:Atp8a1 UTSW 5 67815815 intron probably benign
R4622:Atp8a1 UTSW 5 67682713 intron probably benign
R4639:Atp8a1 UTSW 5 67655974 missense probably benign 0.36
R4664:Atp8a1 UTSW 5 67762586 missense possibly damaging 0.92
R4732:Atp8a1 UTSW 5 67813120 missense probably benign 0.07
R4733:Atp8a1 UTSW 5 67813120 missense probably benign 0.07
R5071:Atp8a1 UTSW 5 67815723 missense probably benign 0.29
R5267:Atp8a1 UTSW 5 67762544 missense probably damaging 1.00
R5314:Atp8a1 UTSW 5 67705905 critical splice donor site probably null
R5424:Atp8a1 UTSW 5 67812100 missense probably damaging 1.00
R5588:Atp8a1 UTSW 5 67814684 missense probably damaging 1.00
R5698:Atp8a1 UTSW 5 67767153 missense probably benign 0.14
R5815:Atp8a1 UTSW 5 67749071 missense probably benign 0.00
R5977:Atp8a1 UTSW 5 67747285 missense possibly damaging 0.94
R6285:Atp8a1 UTSW 5 67667607 missense possibly damaging 0.68
R6341:Atp8a1 UTSW 5 67682927 missense possibly damaging 0.88
R6736:Atp8a1 UTSW 5 67667617 missense probably damaging 1.00
R6746:Atp8a1 UTSW 5 67751049 missense probably benign 0.00
R6887:Atp8a1 UTSW 5 67738451 missense probably benign 0.21
R6946:Atp8a1 UTSW 5 67622625 missense possibly damaging 0.50
R6970:Atp8a1 UTSW 5 67738462 missense probably damaging 1.00
R7035:Atp8a1 UTSW 5 67781030 missense probably benign 0.00
R7218:Atp8a1 UTSW 5 67702981 missense
R7278:Atp8a1 UTSW 5 67624037 missense
R7530:Atp8a1 UTSW 5 67745628 missense
R7548:Atp8a1 UTSW 5 67815728 nonsense probably null
R7594:Atp8a1 UTSW 5 67651592 missense
R7722:Atp8a1 UTSW 5 67622698 critical splice acceptor site probably null
R8152:Atp8a1 UTSW 5 67762582 missense
X0019:Atp8a1 UTSW 5 67749141 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- CGAGGAGACCATGTTGAAGC -3'
(R):5'- TCCTTGTACTCAGATCTCACTACAG -3'

Sequencing Primer
(F):5'- AGACCATGTTGAAGCTATATGGG -3'
(R):5'- GATCTCACTACAGATATAGAGCTGTC -3'
Posted On2015-07-07